Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator IscR in Caulobacterales

Properties
Regulator family: Rrf2
Regulation mode: activator (repressor)
Biological process: Iron-sulfur cluster biogenesis
Effector: Iron-sulfur cluster redox state
Regulog: IscR - Caulobacterales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Caulobacter crescentus CB15
CC1866 iscR -128 8.4 ATACTTGACCGCCGCGCTTGGTCTT
Caulobacter segnis ATCC 21756
Cseg_2153 iscR -127 8.4 ATACTTGACCGCCGCGCTTGGTCTT
Caulobacter sp. K31
Caul_2586 iscR -137 8.4 ATACTTGACCGCTGCGCTTGGTCTT
Phenylobacterium zucineum HLK1
PHZ_c1722 iscR -138 8.1 ATACTTGACTGCTGCGCTAGGTCTT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD