Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator IscR in Sphingomonadales

Properties
Regulator family: Rrf2
Regulation mode: activator (repressor)
Biological process: Iron-sulfur cluster biogenesis
Effector: Iron-sulfur cluster redox state
Regulog: IscR - Sphingomonadales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Erythrobacter litoralis HTCC2594
ELI_12790 iscR -40 7 AAATCGGAACGATTTGGTCCGATTT
Erythrobacter sp. NAP1
NAP1_13233 iscR -61 7.1 AAATCCGACTGATTCAGTCCGATTT
Novosphingobium aromaticivorans DSM 12444
Saro_0194 iscR -53 7.1 TAACCGGAGTGATTCGGTCCGATTT
Sphingopyxis alaskensis RB2256
Sala_0675 iscR -55 5.6 TAAGTGGAGTAATTTACTCTAGTTA
Sphingobium japonicum UT26S
SJA_C1-34000 iscR -51 6.8 CAATCGGATGGATTCGATCCGATTT
Sphingomonas wittichii RW1
Swit_2919 iscR -38 6.7 CAATCGGATCGAATCAGTCCGATTG
Zymomonas mobilis subsp. mobilis ZM4
ZMO0422 iscR -111 6.2 TAATCAGACAAATTTAGTCTTGTTT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD