Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator IscR in Rhodospirillales

Properties
Regulator family: Rrf2
Regulation mode: activator (repressor)
Biological process: Iron-sulfur cluster biogenesis
Effector: Iron-sulfur cluster redox state
Regulog: IscR - Rhodospirillales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Rhodospirillum rubrum ATCC 11170
Rru_A2029 cysE -116 7 ATTCTTGACCGATTTTCTCGGACAC
Magnetospirillum magnetotacticum MS-1
Magn03007535 cysE -193 7.2 AATCTTGACTGGCCTTGTCGGGCAT
Magnetospirillum magneticum AMB-1
amb3031 cysE -117 7.3 AATCTTGACTGGCCTTGTCGGACAT
Azospirillum sp. B510
AZL_020070 cysE -200 7 ATTCTTGACCGTTTTGCTTGGTCAT
Rhodospirillum centenum SW
RC1_1619 cysE -129 6.6 ATACTTGACCATACTGGTAGGTCAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD