Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator IscR in Various betaproteobacteria

Properties
Regulator family: Rrf2
Regulation mode: activator (repressor)
Biological process: Iron-sulfur cluster biogenesis
Effector: Iron-sulfur cluster redox state
Regulog: IscR - Various betaproteobacteria
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Azoarcus sp. EbN1
ebA6404 iscR -91 5.6 GTAGTTGACCGATTTTGTCGGGTTA
ebA6404 iscR -63 5.8 ATAGTCGAGTGAAACGTTCGGGTAT
ebA1175 ydhD -39 5.2 TTACCCGACTGAAACACTCAACTTT
ebA6405 cysE -62 5.8 AAACCCGACTAAACTAGTCGGGAAT
Thauera sp. MZ1T
Tmz1t_2207 iscR -75 5.6 ATACTCGACAAAAATGATGGGATAT
Tmz1t_2207 iscR -103 5.1 TTAGTTGACCGTTTTTGTCGGGATC
Tmz1t_2208 cysE -95 6.1 ATAGTCGATTAAAATTCTCGGGAAT
Dechloromonas aromatica RCB
Daro_1948 iscR -69 6.3 ATAGTTGACTAATTTTCTCTGGTTT
Daro_1948 iscR -40 5.5 ATAGTTGACCTTAATACTAGGTTAT
Daro_1948 iscR -82 5.2 ATACCTGAGCAAAATAGTTGACTAA
Daro_1947 cysE -64 6.1 ATAGCTGACAAATTCAGTCGAGTAT
Nitrosomonas europaea ATCC 19718
NE1452 iscR -100 6.7 ATAGTTGACTAATATTGTCGGGTAT
Nitrosospira multiformis ATCC 25196
Nmul_A0694 iscR -103 6.1 ATAGTTGACTAAATCAGTCATCTAT
Nmul_A0674 iscR -225 5.8 ATACTTGATCAATGTTGTCGGGTAT
Nmul_A0694 iscR -131 6.5 ATAGTTGACTAAATCAATCAGGTAT
Thiobacillus denitrificans
Tbd_2499 ydhD -38 5.1 ATTCCCGAGTATTCCACTCAGGTAT
Tbd_1162 cysE -39 6.5 ATAGTTGACTAAAATACTCGGAAAT
Tbd_1163 iscR -88 6.2 ATAGTTGACTAAATTGCTAAGGTAA
Tbd_1163 iscR -60 6.5 ATAGTTGACTGAAATGCTCGGGAAT
Chromobacterium violaceum ATCC 12472
CV1095 iscR -71 6.6 ATACTTGACTAATTTAGTCGGATAT
Neisseria meningitidis MC58
NMB1378 iscR -74 6.3 ATACTTGACTGAAACACTCAGATAT
Laribacter hongkongensis HLHK9
LHK_02866 iscR -63 6.4 ATGGTTGACTAAATTAGTCGGGTTT
Methylobacillus flagellatus KT
Mfla_0811 cysE -21 4.6 ATTTCAGAGTAAAATAGTCGGATGT
Mfla_0810 iscR -111 6.3 ATAGTTGACTAAAGTATTCAGGTAT
Methylotenera mobilis JLW8
Mmol_1671 iscR -70 6.3 ATAGTTGACTAAAATTGTAAGGAAT
Methylophilales bacterium HTCC2181
MB2181_02935 cysE -84 6 ATACTTGAGTTATTTACTCAGGATT
MB2181_02930 iscR -58 5.6 ATACTTGATAGTTTTAGTCAAGTAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD