Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator IscR in Comamonadaceae

Properties
Regulator family: Rrf2
Regulation mode: activator (repressor)
Biological process: Iron-sulfur cluster biogenesis
Effector: Iron-sulfur cluster redox state
Regulog: IscR - Comamonadaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Acidovorax avenae subsp. citrulli AAC00-1
Aave_2442 iscR -207 5.7 TTACCCGACAAAAACAATAGGGTTT
Aave_2442 iscR -176 5.4 ATACTTGGGCGCAACACTCAAGAAA
Acidovorax sp. JS42
Ajs_2145 iscR -189 5.6 TTACCCGATAAAATTAATAGGGATT
Ajs_2145 iscR -158 5.8 ATACTTGTCTCAAATACTCAAGAAA
Comamonas testosteroni KF-1
CtesDRAFT_1260 iscR -182 5.8 TTACCCGACAAAATTGATGGGGAAT
CtesDRAFT_1260 iscR -152 5.6 ATACTCGCGTCAAACACTCAACAAC
Delftia acidovorans SPH-1
Daci_4000 iscR -192 5.8 TTACCCGACAAAATTGATGGGGAAT
Polaromonas naphthalenivorans CJ2
Pnap_2291 iscR -152 6.3 ATACTTGACGAAATTAGTCAAGAAC
Polaromonas sp. JS666
Bpro_2177 iscR -154 6.3 ATACTTGACGAAAACAGTCAGGAAC
Rhodoferax ferrireducens DSM 15236
Rfer_2176 iscR -52 5.6 ATACTCAACTATATTAGTCAAGTAA
Rfer_2176 iscR -82 5.2 TTACCCGAGTAAATTACTTGGTTTC
Variovorax paradoxus S110
Vapar_2141 iscR -165 5.9 ATACTTGAGCGAAATACTCAACAAC
Vapar_2141 iscR -152 5.4 ATACTCAACAACAACAAAAAAGAAC
Verminephrobacter eiseniae EF01-2
Veis_2372 iscR -216 4.2 TAATCCGACAAATTTGATAAGGATT
Methylibium petroleiphilum PM1
Mpe_A2263 iscR -98 5.1 ATAATTGAGCTATTCAGTCGGGATT
Leptothrix cholodnii SP-6
Lcho_1048 iscR -109 6.1 ATAATCGAGTAAAACACTCGGGAAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD