Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator IscR in Burkholderia

Properties
Regulator family: Rrf2
Regulation mode: activator (repressor)
Biological process: Iron-sulfur cluster biogenesis
Effector: Iron-sulfur cluster redox state
Regulog: IscR - Burkholderia
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Burkholderia pseudomallei K96243
BPSL2290 iscR -69 7.5 ATACTTGACTAAATTGGTCAAATAT
BPSL2290 iscR -42 7.8 ATACTTGACCAAAATCGTCAAGATT
Burkholderia mallei ATCC 23344
BMA1709 iscR -69 7.5 ATACTTGACTAAATTGGTCAAATAT
BMA1709 iscR -42 7.7 ATACTTGACAAAAATCGTCAAGATT
Burkholderia sp. 383
Bcep18194_A5433 iscR -69 7.8 ATACTTGACTAAAATCGTCAAATAT
Bcep18194_A5433 iscR -42 7.8 ATACTTGACCAAAATCGTCAAGATT
Burkholderia cepacia AMMD
Bamb_2164 iscR -42 7.8 ATACTTGACCAAAATCGTCAAGATT
Bamb_2164 iscR -69 7.8 ATACTTGACTAAAATCGTCAAATAT
Burkholderia vietnamiensis G4
Bcep1808_2206 iscR -42 7.8 ATACTTGACCAAAATCGTCAAGATT
Bcep1808_2206 iscR -69 7.5 ATACTTGACTAAAAACGTCAAATAT
Burkholderia glumae BGR1
bglu_1g24710 iscR -68 6.9 ATACTTGACTAAAAATGTCAGATAT
bglu_1g24710 iscR -41 7.8 ATACTTGACCAAAATCGTCAAGATT
Burkholderia xenovorans LB400
Bxe_A1552 iscR -68 7 ATACTTGACTAAATCGGTCATGTAT
Bxe_A1552 iscR -41 7.2 ATACTTGACAAAACTTGTCGAGAAT
Burkholderia phymatum STM815
Bphy_1459 iscR -42 7.3 ATACTTGACCAAACTTGTCGAGAAT
Bphy_1459 iscR -69 7.1 ATACTTGACTAAATCCGTCATGTAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD