Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator IscR in Xanthomonadales

Properties
Regulator family: Rrf2
Regulation mode: activator (repressor)
Biological process: Iron-sulfur cluster biogenesis
Effector: Iron-sulfur cluster redox state
Regulog: IscR - Xanthomonadales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Xylella fastidiosa 9a5c
XF1477 iscR -45 8.3 AAAGCGTACAATTTCTGTCCGCTTT
Xanthomonas axonopodis pv. citri str. 306
XAC2934 iscR -42 8.4 AAAGAGTACAATTTCGGTCCGCTTT
Xanthomonas campestris pv. campestris str. ATCC 33913
XCC2765 iscR -44 8.4 AAAGAGTACAATTTCGGTCCGCTTT
Stenotrophomonas maltophilia K279a
Smlt1158 iscR -44 8.3 AAAGCGTACAATTTCAGTCCGCTTT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD