Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator IscR in Moraxellaceae

Properties
Regulator family: Rrf2
Regulation mode: activator (repressor)
Biological process: Iron-sulfur cluster biogenesis
Effector: Iron-sulfur cluster redox state
Regulog: IscR - Moraxellaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Acinetobacter sp. ADP1
ACIAD1405 iscR -96 8 AAACTTGACTATTTTAGTCAGGATT
Acinetobacter baumannii AB0057
AB57_1857 iscR -66 8.2 AAACTTGACTATTTTAGTCGGGATT
Psychrobacter arcticum 273-4
Psyc_1476 iscR -219 7.9 AATCTTGACTAAATTACTCGGGATT
Psychrobacter sp. PRwf-1
PsycPRwf_1628 iscR -75 8.1 AATCTTGACTAGTTTACTCGGGATT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD