Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator IscR in Pseudomonadaceae

Properties
Regulator family: Rrf2
Regulation mode: activator (repressor)
Biological process: Iron-sulfur cluster biogenesis
Effector: Iron-sulfur cluster redox state
Regulog: IscR - Pseudomonadaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Pseudomonas aeruginosa PAO1
PA0665 erpA -81 6.4 TTAGTTGACCATTTTTCTGGGACAA
PA3815 iscR -71 7.1 ATAGTTGACCTAATTACTCGGATAA
Pseudomonas entomophila L48
PSEEN0461 erpA -79 6.7 ATTCTTGACCGATTTTCTCGGAGAA
PSEEN1009 iscR -70 7 ATAGTTGACTTAAATGCTCGGGAAT
Pseudomonas putida KT2440
PP0433 erpA -32 6.9 ATTCTTGACCGATTTTCTCGGGAAA
PP0841 iscR -70 7 ATAGTTGACTTAAATGCTCGGGAAT
Pseudomonas syringae pv. tomato str. DC3000
PSPTO1422 iscR -65 7.1 ATAGTTGACTAATTTGCTCGGGAAT
PSPTO0605 erpA -93 6.9 ATAGTTGACCGATTTTCTAGGAGAA
Pseudomonas fluorescens Pf-5
PFL_4966 iscR -66 7 ATAGTTGACCTGATTACTCGGGTAT
PFL_5610 erpA -81 6.7 ATAGTTGACCGCTTTTCTGGGAGAA
Pseudomonas mendocina ymp
Pmen_3930 erpA -77 7.3 ATAGTTGACCAATTTTCTCGGGCAA
Pmen_3512 iscR -64 7 ATAGTTGACTTAAATACTCGGGAAT
Pseudomonas stutzeri A1501
PST_3043 iscR -4 6.9 ATAGTTGACTCAAATACTCGGGAAT
PST_0755 erpA -76 6.5 ATAGTTGACCGGTTTTGTCAGGCAA
Azotobacter vinelandii AvOP
Avin_40410 iscR -65 6.1 ATAGTTGATCCTGTTTGTCGGGTAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD