Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator IscR in Oceanospirillales/Alteromonadales

Properties
Regulator family: Rrf2
Regulation mode: activator (repressor)
Biological process: Iron-sulfur cluster biogenesis
Effector: Iron-sulfur cluster redox state
Regulog: IscR - Oceanospirillales/Alteromonadales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Hahella chejuensis KCTC 2396
HCH_04462 iscR -59 5 ATACTTGATCAGTTTGCAGGGTCAT
HCH_02543 nfuA -86 5.1 AAATCCTACTAATTTGCTAAGGCTT
HCH_06242 erpA -103 5.5 ATAGTTGACCGATTAAGTAGGATAA
Marinobacter aqueolei
Maqu_1121 iscR -78 5.9 ATACTTGACTGTTTTAGTTGGTCAA
Maqu_3151 sufB -223 6.3 ATACCTGACTATTTTACTCTGGTAT
Maqu_1525 nfuA -82 5.5 ATGCCCGACTATTTTACTTGGTCTT
Maqu_0694 erpA -87 6 ATAGTTGATTGTTTTAGTCAGGAAT
Marinobacter sp. ELB17
MELB17_04217 sufB -131 6.2 ATACCTGACTAAAATACTCTGGTAT
MELB17_11313 iscR -77 6.1 ATACTTGACTGAATTAGTAGGTCAA
MELB17_20316 erpA -66 6 ATAGTTGATTGTTTTAGTCAGGAAT
Oceanobacter sp. RED65
RED65_06117 iscR -74 6.2 AAAGTTGACTAAAATACTCGGGTTT
RED65_11832 erpA -70 5.7 TTAGTTGACTAGAATACTCGGGTTT
RED65_07139 nfuA -78 5.3 ATACCCGAGTAAAAAACTAGGGATT
Oceanospirillum sp. MED92
MED92_00535 iscR -68 5.4 TTAATTGACCTTTTTGGTCGGGTAT
MED92_17445 erpA -61 6.1 ATACTTGACTGAATTGCTTGGTTAA
MED92_12256 nfuA -79 6.1 ATAGTTGATCAATTTACTCGGGATT
Marinomonas sp. MWYL1
Mmwyl1_1343 iscR -93 5.5 ATAACCTACTAAAATAGTCAGGTAA
Mmwyl1_1343 iscR -68 5.3 ATACTTGATCAAAACAGTAGGATTT
Mmwyl1_1012 erpA -66 6.3 ATACTTGACTAAATTACTCGGATAA
Mmwyl1_2344 nfuA -93 5.3 ATACCCTACTTTTTTACTTGGTCTT
Saccharophagus degradans 2-40
Sde_2438 ydhD -68 5.4 ATACCCGAGTAAATAACTCAGATTT
Sde_1412 iscR -61 6 ATACTTGATTGAAATGCTAGGTTAT
Sde_0836 erpA -66 6.1 ATACTTGATTGTTTTAGTCGGTTAA
Sde_2009 nfuA -38 5.4 ATAACCGACAAATTTACTAGGTCTT
Teredinibacter turnerae T7901
TERTU_2649 iscR -64 6.1 ATAGTTGACCGCATTACTCGGTTAT
TERTU_3061 erpA -86 5.8 ATACTTGACTGAAACACTCGGGTAC
TERTU_2127 nfuA -69 5.8 ATACCCAACTAAATTAGTAGGGTAT
Cellvibrio japonicus Ueda107
CJA_2843 ydhD -74 6 ATACTTGACTGCATTACTTGGTTTT
CJA_1465 iscR -131 6.1 ATAGTTGAGTAAAATACTCGGGTTT
CJA_0888 erpA -76 6 ATAGTTGACTGTTTTGCTGGGGTAA
CJA_2541 nfuA -66 5.6 ATACCCGAGTATTTTAATCAGGTAT
Chromohalobacter salexigens DSM 3043
Csal_2847 iscR -71 5 ATGGTTGACCGCGTTACTGGGTTTT
Csal_3299 erpA -76 5.5 AAAGTTGACCGTTTTGCTTGGTCTT
Reinekea sp. MED297
MED297_14062 ydhD -25 5.4 ATATCTGAGCGATTTGGTAGGTTAT
MED297_01820 nfuA -86 6.2 AAAGCTGACTAAATTACTCAGGTAT
MED297_14930 iscR -107 6.3 ATAGTTGACTGTTTTGCTCAGGTAT
MED297_10476 erpA -63 6.3 ATAGTTGACTGTTTTGCTCAGGTAT
Alcanivorax borkumensis SK2
ABO_1865 sufB -45 6.2 ATACCCGACTAAATTACTCTGGTAT
ABO_1873 iscR -66 6 ATACTTGACCAAATTGCTCAGGATT
ABO_1190 nfuA -101 5.5 GTACCTGACTAAAATAGTCAGGAAA
ABO_0362 erpA 9 5.8 ATTCTTGACTGTTTTAGTCGGGTAC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD