Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator IscR in Psychromonadaceae/Aeromonadales

Properties
Regulator family: Rrf2
Regulation mode: activator (repressor)
Biological process: Iron-sulfur cluster biogenesis
Effector: Iron-sulfur cluster redox state
Regulog: IscR - Psychromonadaceae/Aeromonadales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Psychromonas ingrahamii 37
Ping_1323 iscR -106 6.9 TTACTTGACTATTTTTGTCAGGTAT
Ping_1323 iscR -133 6.7 TTACCTGACTATTTTTGTCAGGTAT
Ping_0867 erpA -65 6.7 ATACTTGAACTAATTAGTCAGGTAC
Psychromonas sp. CNPT3
PCNPT3_05479 iscR -99 6.9 TTAGTTGACTAATTTAGTAGGGTAT
PCNPT3_04157 erpA -63 7.1 ATAGTTGAACTAATTAGTCGGGTAT
Moritella sp. PE36
PE36_21624 iscR -62 7.1 ATACTTGACCATTTCAGTCGGGTAT
PE36_21624 iscR -87 6.9 ATACCTGAGTAAATTAGTCAGGTAT
PE36_05088 erpA -67 7.2 ATAGTTGACTGAATTAGTCAGGTAT
Aeromonas hydrophila subsp. hydrophila ATCC 7966
AHA_1746 iscR -70 7.5 ATACTTGACTGATTTAGTCGGGTAT
AHA_3517 erpA -24 6.6 ATACTTGAACTGAATGGTCGGGTAT
Aeromonas salmonicida subsp. salmonicida A449
ASA_2613 iscR -70 7.4 ATACTTGACTGTTTTAGTCGGGTAT
ASA_0800 erpA -78 6.9 ATACTTGAACTAAACAGTCGGGTAT
Tolumonas auensis DSM 9187
Tola_2020 iscR -56 6.1 ATACTTGACTGAAAAAGTAGGACAT
Tola_0580 erpA -94 7 ATACTTGAACTGTTTAGTCAGGTAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD