Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator IscR in Alteromonadales

Properties
Regulator family: Rrf2
Regulation mode: activator (repressor)
Biological process: Iron-sulfur cluster biogenesis
Effector: Iron-sulfur cluster redox state
Regulog: IscR - Alteromonadales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Pseudoalteromonas atlantica T6c
Patl_1237 iscR -87 6.5 ATACTTGACTAAAACAGTAGGATAA
Patl_1237 iscR -62 7 ATACTTGACTAAAATAGTCGGGTTT
Patl_0544 erpA -118 6.2 ATAGTTGATAAGATTAGTCAGGTAT
Patl_4233 nfuA -68 6.1 TTACTTGAGTGTTTTAGTCAAGTAA
Alteromonas macleodii 'Deep ecotype'
MADE_01355 iscR -88 6.1 ATACTTGACTAATTTACTGGGTTTT
MADE_01355 iscR -63 6.9 ATACTTGACCATTTTAGTCAGGTAT
MADE_01357 sufB -227 6.6 ATATTTGAGTGAAATAGTCGGGTAT
MADE_03996 nfuA -69 6.5 ATACCTGACTGTTTTAGTCAGGTAA
Glaciecola sp. HTCC2999
GHTCC_010100002924 iscR -62 7.3 ATACTTGACTAATTTAGTCGGGTAA
GHTCC_010100002924 iscR -87 7 ATACTTGACTAAATTAGTCGGTTAA
GHTCC_010100001060 erpA -66 6.6 ATACTTGATGAATTTACTCAAGTAT
GHTCC_010100008811 nfuA -72 6.7 ATACTTGACTGTTTTAGTCGGGTAA
Colwellia psychrerythraea 34H
CPS_3475 ydhD -216 6.5 AAACTTGAGTAAAATACTCAAGTAT
CPS_1131 iscR -199 6.5 ATACCTGAGTAAATCACTAGGGTAT
CPS_1131 iscR -254 6.3 ATAGTTGAGTAAAACAGTCAACTAT
CPS_4622 erpA -101 6.9 ATACTTGACTAAAATAGTCAAGTTT
CPS_0220 nfuA -94 7.1 ATACTTGAGTAAAACAGTCAGGTAT
Alteromonadales bacterium TW-7
ATW7_06868 ydhD -162 5.7 ATTGTTGAGTATTTTACTCAAGTTT
ATW7_10453 erpA -62 6.9 ATACTTGATTAAAACACTCGGGTAT
ATW7_17107 nfuA -37 6.2 GTATCCGAGTAATTTAGTCAGGTAT
ATW7_18135 iscR -57 7 ATACTTGACTAATTTACTCTGGTAA
ATW7_18135 iscR -148 6 ATACTTGACCAAACAGGTCAGGTAT
ATW7_18135 iscR -187 7.3 ATACTTGACTAAATTACTCAGGTAA
Pseudoalteromonas haloplanktis TAC125
PSHAa1216 ydhD -163 5.3 ATTGTTGAGTATTCTACTCAAGTTT
PSHAa2251 erpA -62 6.9 ATACTTGATTAAAACACTCGGGTAT
PSHAa2860 nfuA -35 6 GTATCCGAGTAATTTAGTCAAGTAT
PSHAa2672 iscR -58 7 ATACTTGACTAATTTACTCTGGTAA
PSHAa2672 iscR -117 7 ATACTTGAGTAAAACACTCAGGTAT
PSHAa2672 iscR -157 7.3 ATACTTGACTAAATTACTCAGGTAA
Pseudoalteromonas tunicata D2
PTD2_10759 ydhD -164 5 AATCCCGAGTATTTTACTCAAGTTT
PTD2_13944 iscR -107 7.3 ATACTTGACTAAATTAGTCGGGTAA
PTD2_13944 iscR -149 7.4 ATACTTGACTAAATTAGTCGGGTAT
PTD2_13944 iscR -66 6.4 ATACTTGACTCTTTTAGTCAGGTTA
PTD2_12764 erpA -62 6.6 GTACTTGATTAAAACACTCGGGTAT
PTD2_16836 nfuA -35 6.1 ATACCCGAGTATTTTAGTCAACTAT
Idiomarina baltica OS145
OS145_02245 nfuA -40 5.2 AAAACCTAGTAAATTACTCAAGTAT
OS145_02725 sufB -65 5.8 AAAGTTGAGTGTTTTACTCGGGTAT
OS145_04890 iscR -75 6.6 ATACTTGACTAATTTAGTCGGAAAA
Idiomarina loihiensis L2TR
IL1804 ydhD -44 5 ATACCTGAGTGTTTTAATCAACCAT
IL0154 sufB -86 5.9 AAAGTTGAGTGTTTTAGTCAGGTAT
IL2240 erpA -64 6.9 ATACTTGACCAAAATACTCAGGTAA
IL0248 nfuA -45 6.3 ATACCCTAGTAATTTACTCAGGTAT
IL2041 iscR -74 7 ATACTTGACTAAAATAGTCGGGAAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD