Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator IscR in Pasteurellales

Properties
Regulator family: Rrf2
Regulation mode: activator (repressor)
Biological process: Iron-sulfur cluster biogenesis
Effector: Iron-sulfur cluster redox state
Regulog: IscR - Pasteurellales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Haemophilus influenzae Rd KW20
HI0433 nfuA -38 4.8 ATTCCCGATACTTTCTCTCAAGTAT
HI0379 iscR -60 6.3 ATAATTGACTAAATTAGTCAGATAT
Aggregatibacter aphrophilus NJ8700
NT05HA_0581 erpA -67 4.9 ATTCTTGAATGCCTTAGAGGGTTAT
NT05HA_1766 nfuA -43 5.3 ATGCCCGACAAAATCAATCAAGTTT
NT05HA_1200 iscR -68 5.2 ATAGTTGACTAAACAAGTCAACAAT
Pasteurella multocida subsp. multocida str. Pm70
PM0458 erpA -65 6.2 ATTCTTGAACGAATTAGTCGGTTAT
PM1557 nfuA -46 5.8 ATTCTTGACAATCTTACTCAAGTAT
PM0317 iscR -69 5.9 ATAGTTGACTAATTTAGTATGATAT
Mannheimia succiniciproducens MBEL55E
MS1307 erpA -73 5.7 TTGGTTGAACGAATTAGTCGGTTAT
MS2232 nfuA -59 5.7 ATTCCCGACTATGTTAGTCAGCTAT
MS1727 iscR -69 6.2 ATAGTTGACTAATTTACTTGGTTAT
Actinobacillus succinogenes 130Z
Asuc_1030 erpA -73 5.7 ATCCTTGAACGAATCAGTCGGTTAT
Asuc_0296 nfuA -40 4.6 ATTTCCGACCGTAAAACTCAGATAA
Asuc_0863 iscR -64 6 ATAGTTGATTAATTTGGTTGGTTAT
Haemophilus somnus 2336
HSM_1296 erpA -64 5.3 AATCTTGAATGGTTTGGTTGGTTAT
HSM_0510 nfuA -43 6 ATTCCTGATAATTTTACTCAAGTAT
HSM_0153 iscR -65 5.2 GAAGTTGACTAATTTAGTAGGATTA
Actinobacillus pleuropneumoniae serovar 7 str. AP76
APP7_0151 nfuA -49 5.6 ATATCCGATAAATTTAGTCAATTAA
APP7_0990 iscR -83 5.9 ATTCTTGACTGTAACAGTCAGGTAT
Haemophilus ducreyi 35000HP
HD0378 nfuA -47 5.6 ATGGCTGATAATTTTAGTCAAGTTA
HD1080 iscR -75 6.2 ATGCTTGACTAAAATAGTCGAGTAT
Haemophilus parasuis SH0165
HAPS_0052 iscR -70 6 AATATTGACTAAATTAGTAGGGTAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD