Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator IscR in Vibrionales

Properties
Regulator family: Rrf2
Regulation mode: activator (repressor)
Biological process: Iron-sulfur cluster biogenesis
Effector: Iron-sulfur cluster redox state
Regulog: IscR - Vibrionales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Vibrio cholerae O1 biovar eltor str. N16961
VC2720 nfuA -30 4.6 ATAACCTATTCTTTTACTCAGGTAT
VC0747 iscR -23 6.9 ATACTTGACCAAAAGAGTCAAGTAT
VC0747 iscR -48 6.9 ATACCTGACTAAATTAGTCAAATAA
VC0627 erpA -114 5.2 ATACTTGAACGGCCAACTCAGGTAT
Vibrio vulnificus CMCP6
VV1_0864 nfuA 9 4.9 ATAACCTACAAATTTACTCGGGTAT
VV1_0439 iscR -93 6.7 ATACCTGACTATTTTAGTCAAATAA
VV1_0439 iscR -68 7 ATACTTGACCATTTTGGTCAGGTAT
VV1_1679 erpA -175 6.9 ATACTTGAACGTATTGGTCAGGTAT
Vibrio harveyi ATCC BAA-1116
VIBHAR_00614 nfuA -30 5.1 ATAGCCTACAAATTTACTCAGGTAT
VIBHAR_01054 iscR -93 6.9 ATACCTGACTAAAATAGTCAAATAA
VIBHAR_01054 iscR -68 6.7 ATACTTGACCGTTTTGGTCGGGTAT
VIBHAR_03416 erpA -87 6.7 ATACTTGAACGAGTTTGTCAGGTAT
Vibrio parahaemolyticus RIMD 2210633
VP0146 nfuA -30 4.8 GTAACCTACAAAATTACTCAGGTAT
VP0595 iscR -93 6.5 ATACCTGAGTAATTTAGTCAAATAA
VP0595 iscR -68 6.7 ATACTTGACCATTTTACTCGGGTAT
VP2474 erpA -103 6.7 ATACTTGAACGAGTTTGTCAGGTAT
Vibrio shilonii AK1
VSAK1_13428 nfuA 6 4.6 ATAACCTACAACTATACTCAGGTAT
VSAK1_12120 iscR -91 6.7 ATACCTGACTATTTTAGTCAAATAA
VSAK1_12120 iscR -66 7 ATACTTGATTAAAATAGTCAGGTAT
VSAK1_05110 erpA -169 6.7 ATACTTGAACGAAGCAGTCAGGTAT
Vibrio splendidus LGP32
VS_0606 iscR -92 6.7 ATACCTGACTAAAATAGTCAACTAA
VS_0606 iscR -67 7.2 ATACTTGACCAATTTAGTCGGGTAT
VS_2501 erpA -87 6.8 ATACTTGAACGTTTCAGTCAGGTAT
Vibrio fischeri ES114
VF_2461 nfuA -30 4.9 TAATCATACTAAATTAGTCAGGTAT
VF_0616 iscR -69 7.4 ATACTTGACCAAAATAGTCAGGTAT
VF_0616 iscR -94 6.3 GTACTTGACTAAAATAGTAGGATAA
VF_2134 erpA -75 7 ATACTTGAATGAAACAGTCAGGTAT
Vibrio salmonicida LFI1238
VSAL_I2911 nfuA -30 4.9 TAATCATACTAATTTAGTCAGGTAT
VSAL_I0716 iscR -69 7.2 ATACTTGACCAAAATGGTCAGGTAT
VSAL_I0716 iscR -94 6.7 ATACTTGACTAAAATAGTAGGATAA
VSAL_I2571 erpA -75 7 ATACTTGAATGAAACAGTCAGGTAT
Vibrio angustum S14
VAS14_21772 nfuA -37 5.1 AAAACTCACTAAATAGGTCAGGTAT
VAS14_06718 iscR -103 6.7 ATACTTGACCAATTTAGTATGGTAT
VAS14_06718 iscR -128 5.8 ATACCCTACTAGAACAGTCAGGTAA
VAS14_07789 erpA -68 7 ATACTTGAACAACATAGTCAGGTAT
Photobacterium profundum SS9
PBPRA0177 nfuA -37 5.3 AAATCTTACTAAATAGGTCAGGTAT
PBPRA0749 iscR -66 7.1 ATACTTGACCATTTTAGTCGGGTAT
PBPRA0749 iscR -91 6.4 AAACCTGACTAAAATCGTCAGGTAA
PBPRA0531 erpA -68 7.1 ATACTTGAACAAGTTAGTCAGGTAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD