Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator HutC in Various betaproteobacteria

Properties
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Histidine utilization
Effector: cis-Urocanic acid
Regulog: HutC - Various betaproteobacteria
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Chromobacterium violaceum ATCC 12472
CV0321 hutI -35 4.7 TTAATTGTATATACAAATAA
CV0321 hutI -184 4.1 TAAACGGTATATACAATTGG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD