Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator HutC in Comamonadaceae

Properties
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Histidine utilization
Effector: cis-Urocanic acid
Regulog: HutC - Comamonadaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Acidovorax avenae subsp. citrulli AAC00-1
Aave_2969 hisX -85 5.1 AACCCTGTATAGACAGCATG
Aave_2965 hutH -24 5.2 TGACTTGTATATACAGGAAA
Aave_2965 hutH -102 5.6 CAGCCTGTATATACAAGTTG
Comamonas testosteroni KF-1
CtesDRAFT_4040 hutC -80 4.9 AAAGTTGTCTATACGAATTT
CtesDRAFT_4035 hisX -117 5.1 AAGCCTGTATATACATGTTC
CtesDRAFT_4039 hutH -24 4.6 TTGACTGTATAGACAGGTAT
CtesDRAFT_4041 COG1457 (CodB) -85 4.9 AAATTCGTATAGACAACTTT
CtesDRAFT_4035 hisX -164 4.5 ATGCATGTCTATACAGCTGT
Delftia acidovorans SPH-1
Daci_0145 hisX -217 5 CAGGTTGTATGGACAAGCTT
Daci_0145 hisX -115 5.1 AATCCTGTATATACATGTCC
Daci_0094 hisT -449 5.2 CATATTGTATATACAGGCTT
Daci_0149 hutH -67 4.9 GATATTGTATAGACAGGCAT
Polaromonas sp. JS666
Bpro_1159 COG2855 -120 5.3 CAACTTGTATATACAAGCGA
Bpro_1164 hutU -99 5.7 CAAGTTGTATAGACAACTAC
Bpro_1158 COG1732 (OpuBC) -158 5.3 TCGCTTGTATATACAAGTTG
Bpro_1165 hutC -98 5.7 GTAGTTGTCTATACAACTTG
Bpro_1043 hutH -25 5.6 CAACTTGTATATACAGGACT
Bpro_1047 hisX -109 5.4 TTACCTGTATATACAGGTTG
Bpro_1047 hisX -231 4.7 ATACCTGTATAGACAGCGCA
Rhodoferax ferrireducens DSM 15236
Rfer_4161 COG1414 -221 5.8 AAAGTTGTCTATACAACTTA
Variovorax paradoxus S110
Vapar_0154 hisX -176 5.1 CTTCCTGTATAGACAGCAAT
Vapar_0154 hisX -110 5.7 TATCCTGTATATACAAGTTG
Vapar_0158 hutH -22 5.6 CTACTTGTATAGACAGGTTC
Verminephrobacter eiseniae EF01-2
Veis_3641 hisX -100 5.4 CAACCTGTATAGACAGGAAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD