Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator HutC in Burkholderia

Properties
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Histidine utilization
Effector: cis-Urocanic acid
Regulog: HutC - Burkholderia
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Burkholderia pseudomallei K96243
BPSL2344 hutH -70 5.8 CAAGTTGTCTATACAACATC
BPSS1752 COG1457 (CodB) -71 5.1 ACAGTTGTCTATACAATTTT
BPSS0981 hisQ -140 5.1 AAAGTTGTACATACAACTTC
BPSL2344 hutH -25 5.5 AAACTTGTATAGACAGGACC
BPSL1280 hisT -79 5.9 CAAGTTGTCTATACAACTTC
Burkholderia mallei ATCC 23344
BMAA0417 COG1457 (CodB) -71 5.1 ACAGTTGTCTATACAATTTT
BMAA1240 hisQ -140 5.1 AAAGTTGTACATACAACTTC
BMA1774 hisT -79 5.9 CAAGTTGTCTATACAACTTC
BMA0645 hutH -4 5.8 CAAGTTGTCTATACAACATC
Burkholderia sp. 383
Bcep18194_B0073 COG834 (HisJ) -340 4.4 CTCCCTGTATAGACATCACC
Bcep18194_A5482 hutH -26 5.6 GAACTTGTCTAGACAGGATT
Bcep18194_B0073 COG834 (HisJ) -132 4.3 TGAGCGGTCTAGACTGCATC
Bcep18194_A4320 hisT -77 5.9 TAAGTTGTCTATACAACTTG
Bcep18194_A5482 hutH -71 5.5 CGGGTTGTCTAGACAAGTTG
Bcep18194_A5483 COG834 (HisJ) -207 5.6 AATCCTGTCTAGACAAGTTC
Bcep18194_A5483 COG834 (HisJ) -162 5.5 CAACTTGTCTAGACAACCCG
Bcep18194_A4383 COG1457 (CodB) -196 5.9 CAAGTTGTATATACAAGATC
Bcep18194_B2378 hisJ -141 5.3 AAAGTTGTATGTACAACTTG
Burkholderia cepacia AMMD
Bamb_1095 hisT -77 5.9 CAAGTTGTATAGACAACTTG
Bamb_2211 hutH -71 5.5 GGGGTTGTCTAGACAAGTTC
Bamb_2211 hutH -26 5.6 GAACTTGTCTAGACAGGATT
Bamb_2212 COG834 (HisJ) -148 5.6 AATCCTGTCTAGACAAGTTC
Bamb_5462 hutC -225 3.7 GCATTTGTCTATACTTTTCC
Bamb_1129 COG1457 (CodB) -150 5.7 CAAGTTGTATATACAAGAAT
Bamb_5463 hisJ -113 5.3 AAAGTTGTATGTACAACTTG
Bamb_2212 COG834 (HisJ) -103 5.5 GAACTTGTCTAGACAACCCC
Bamb_4897 COG834 (HisJ) -137 4.4 CGAGCGGTCTAGACTGCATC
Burkholderia vietnamiensis G4
Bcep1808_5569 hisJ2 -235 4.3 AAATTTGTCTAGTCATCCTG
Bcep1808_1206 COG1457 (CodB) -169 5.5 CTAGTTGTATATACAACAAT
Bcep1808_5569 hisJ2 -75 5.1 ATGCTTGTATAGACAAATTC
Bcep1808_2247 hutH -26 5.6 GAACTTGTCTAGACAGGATT
Bcep1808_2247 hutH -71 5.3 CGGGTTGTCTAGACAAGTCG
Burkholderia glumae BGR1
bglu_1g18060 hisJ2 -72 5.5 ATTCTTGTCTATACAAGATC
bglu_2g11350 hisT -69 5.5 GAACCTGTCTAGACAAGCTC
bglu_1g25210 hutH -69 5.4 CGAATTGTCTATACAAGTTG
bglu_1g25210 hutH -26 5.1 TCACTTGTATAGACAGGACG
Burkholderia xenovorans LB400
Bxe_A2947 hutH -64 5.7 CAAGTTGTATATACAAGAAG
Bxe_A2947 hutH -206 5.4 TAAGGTGTATATACAAGTTA
Bxe_B1829 hisJ2 -240 5.1 CAACCTGTCTAGACAAAACA
Bxe_B1829 hisJ2 -67 5.3 AGACTTGTCTATACAAATTA
Bxe_A2947 hutH -26 5 CGAATTGTATAGACAGGACG
Burkholderia phymatum STM815
Bphy_1814 hutH -217 5.3 GGACGTGTATATACAAGTTG
Bphy_5100 hisJ2 -218 4.3 GAACATGTCTAGTCAGCTGC
Bphy_1814 hutH -27 5.1 GAAATTGTATAGACAGGAAC
Bphy_1814 hutH -64 5.7 CGAGTTGTATATACAAGATG
Bphy_5100 hisJ2 -66 5.1 AGACTTGTCTATACATGTCC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD