Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator HutC in Xanthomonadales

Properties
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Histidine utilization
Effector: cis-Urocanic acid
Regulog: HutC - Xanthomonadales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Xanthomonas axonopodis pv. citri str. 306
XAC1638 hutI -39 4.6 TCTATTGTATATACATATCA
XAC1639 hutF -56 4.4 TGATATGTATATACAATAGA
Xanthomonas campestris pv. campestris str. ATCC 33913
XCC1581 hutI -39 4.6 TCTATTGTATATACATATCA
XCC1580 hutF -56 4.4 TGATATGTATATACAATAGA
Stenotrophomonas maltophilia K279a
Smlt3107 hutI -33 5 TATATTGTATAGACATATAA
Smlt3106 hutF -45 4.3 TTATATGTCTATACAATATA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD