Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator HutC in Moraxellaceae

Properties
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Histidine utilization
Effector: cis-Urocanic acid
Regulog: HutC - Moraxellaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Acinetobacter baumannii AB0057
AB57_3862 hutC -67 4.5 GTGGTTGTATATACATAGCA
AB57_3860 hutU -90 5.6 ATGGATGTATATACAAGTTA
AB57_1739 COG1457 (CodB) -83 6 TAACTTGTATATACATGTTT
Psychrobacter sp. PRwf-1
PsycPRwf_0851 COG3314 -207 4 TAATTTGTCTATAGACATAG
PsycPRwf_0851 COG3314 -28 4 TTATTGCTACAGACAAGGAT
PsycPRwf_0853 hutC -156 5 GATTTTGTATATACAAATTA
PsycPRwf_0852 hutU -54 5 TAATTTGTATATACAAAATC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD