Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator HutC in Pseudomonadaceae

Properties
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Histidine utilization
Effector: cis-Urocanic acid
Regulog: HutC - Pseudomonadaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Pseudomonas aeruginosa PAO1
PA5106 hutF -43 5.4 GTATATGTATATACAAATAA
PA5100 hutU -121 5.9 ATACTTGTATGTACAAGCAT
PA5105 hutC -77 5.4 TTATTTGTATATACATATAC
Pseudomonas entomophila L48
PSEEN5097 hutU -84 6.5 ATGCTTGTACATACAAGTAA
PSEEN3026 COG1457 (CodB) -101 5.1 AGACTTGTATATACATGCTC
PSEEN5100 hutF -41 5.2 GTATATGTATATACAAGTTG
PSEEN5099 hutC -88 5.2 CAACTTGTATATACATATAC
Pseudomonas putida KT2440
PP5036 hutF -40 5.4 GTATATGTATATACAAGTTA
PP5033 hutU -82 6.5 ATGCTTGTACATACAAGTAA
PP5035 hutC -88 5.5 TAACTTGTATATACATATAC
Pseudomonas syringae pv. tomato str. DC3000
PSPTO5171 hutF -41 5 GTATATGTATATACAAATTA
PSPTO5270 hutU -10 4.6 TTGATTGCATATGCTTGTAT
PSPTO5270 hutU 0 5.9 ATGCTTGTATGTACAAGTAG
PSPTO5172 hutC -142 5.3 TAATTTGTATATACATATAC
Pseudomonas fluorescens Pf-5
PFL_0398 hutF -42 5.4 GTATATGTATATACAAATAA
PFL_0401 hutU -86 6.1 ATGCTTGTATGTACAAGTAA
PFL_0401 hutU -96 4.6 TTGATTGCATATGCTTGTAT
PFL_0399 hutC -85 5.4 TTATTTGTATATACATATAC
Pseudomonas mendocina ymp
Pmen_4074 hutD -212 4.6 TGTTTTGTATATACAATATG
Pmen_4074 hutD -27 4.2 GACCATGTATATACATTTGG
Pmen_4073 hutI -220 3.8 CCAAATGTATATACATGGTC
Pmen_4073 hutI -35 4.4 CATATTGTATATACAAAACA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD