Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator HutC in Oceanospirillales/Alteromonadales

Properties
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Histidine utilization
Effector: cis-Urocanic acid
Regulog: HutC - Oceanospirillales/Alteromonadales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Hahella chejuensis KCTC 2396
HCH_04169 hutI -47 5.5 TTAAATGTATATACATTTAT
HCH_04169 hutI -291 5.6 AAATTTGTATATACATTCAA
Marinomonas sp. MWYL1
Mmwyl1_2465 COG3314 -4 5.1 TAATATGTATATACATGTTG
Mmwyl1_2465 COG3314 -212 4 TGCTATGTATAGACAACCTT
Mmwyl1_3903 hutF -65 5.3 ATACTTGTATATACATTATA
Mmwyl1_3903 hutF -249 5.1 GAACATGTATATACAATTAC
Mmwyl1_3905 hutC -73 4.5 CTAGATGTATAGACAAGTTG
Mmwyl1_3902 hutU -257 5.6 TATAATGTATATACAAGTAT
Mmwyl1_3902 hutU -73 5.1 GTAATTGTATATACATGTTC
Reinekea sp. MED297
MED297_04904 hutI -35 5.4 CAAGTTGTATATACAACTAA
MED297_04899 hutC -52 5.2 TTAGTTGTATATACAACTTG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD