Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator HutC in Psychromonadaceae/Aeromonadales

Properties
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Histidine utilization
Effector: cis-Urocanic acid
Regulog: HutC - Psychromonadaceae/Aeromonadales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Psychromonas ingrahamii 37
Ping_1033 hutC -44 5.2 TTATTTGTATAGTCAATTAA
Ping_1950 COG3314 -95 4.6 TTAAATGTATACACATTTTA
Ping_1950 COG3314 -232 5.3 TATTGTGTATATACAATTAT
Ping_1032 hutI -35 5.7 CTAATTGTATATACATTTAA
Moritella sp. PE36
PE36_09016 hutC -80 4.7 TCATTTGTATAGTCAATTAA
PE36_09011 hutI -35 5.9 TTAATTGTATATACATTTAA
Aeromonas hydrophila subsp. hydrophila ATCC 7966
AHA_0377 hutI -90 4.9 TTAATTGTATATACAAACTC
Aeromonas salmonicida subsp. salmonicida A449
ASA_2086 COG3314 -61 4.9 AGCATTGTATATACAATTCG
ASA_3955 hutI -28 4.6 GATAATGTATATACATTTAG
ASA_3955 hutI -159 5.2 TTAATTGTATATACATATTG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD