Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator HutC in Vibrionales

Properties
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Histidine utilization
Effector: cis-Urocanic acid
Regulog: HutC - Vibrionales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Vibrio cholerae O1 biovar eltor str. N16961
VC1205 hutI -45 5.4 TTATTTGTATATACATTTGA
VC1206 hutC -40 4.1 TGATTTGTCTATGCAAATGA
Vibrio vulnificus CMCP6
VV1_2392 hutI -47 5.8 TTATTTGTATATACATTTAG
VV1_2393 hutC -30 4.8 CTATTTGTATAGTCAATTAG
Vibrio harveyi ATCC BAA-1116
VIBHAR_02075 hutI -47 6 TTATTTGTATATACATTTAA
VIBHAR_02076 hutC -32 5 CTATTTGTATAGTCAATTAA
Vibrio parahaemolyticus RIMD 2210633
VP1276 hutI -48 6 TTATTTGTATATACATTTAA
VP1277 hutC -32 4.6 GTATTTGTATAGTCAATTTA
Vibrio shilonii AK1
VSAK1_17057 hutI -34 5.7 ATATTTGTATATACAATAAA
VSAK1_17047 hutC -38 4.6 CCATTTGTATATTCAATTTA
Vibrio splendidus LGP32
VS_1219 hutI -38 6 TTATTTGTATATACATTTAA
VS_1220 hutC -29 4.9 CTATTTGTATAGTCAAATAA
Vibrio fischeri ES114
VF_A0453 hutI -59 5.7 TTATTTGTATATACATATAG
VF_A0454 hutC -33 4.9 TTATTTGTATAGTCAATTTA
Vibrio salmonicida LFI1238
VSAL_II0705 hutI -52 5.5 TTATTTGTATATACATATTA
VSAL_II0704 hutC -33 4.9 TTATTTGTATAGTCAATTTA
Vibrio angustum S14
VAS14_08550 hutI -40 5.1 ACATTTGTATAGACATTTAA
VAS14_08555 hutC -34 4.5 TAATTTGTATATACACAATA
Photobacterium profundum SS9
PBPRA2170 hutI -68 5.3 TTATTTGTATATACATATTG
PBPRA2169 hutC -32 5.2 TTATTTGTATAGGCAATTAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD