Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator HutC in Enterobacteriales

Properties
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Histidine utilization
Effector: cis-Urocanic acid
Regulog: HutC - Enterobacteriales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Salmonella typhimurium LT2
STM0787 hutI -43 4.7 ATAAATGTCTATACAACCCA
Citrobacter koseri ATCC BAA-895
CKO_02360 hutI -29 4.7 ATAAATGTATAGACAACCCA
CKO_02357 hutU -61 5.3 CAAGTTGTATAGACAAGTAT
CKO_02925 COG1732 (OpuBC) -50 6 TGGTTTGTATATACAAGTAA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
KPN_01286 COG1457 (CodB) -111 5.9 ATGCTTGTATATACAAGAAC
KPN_00792 hutI -36 4.7 ATAAATGTCTATACAACCCA
KPN_01285 hutD -147 5.9 GTTCTTGTATATACAAGCAT
KPN_00795 hutU -62 6.1 ATGCTTGTATAGACAAGTAT
Enterobacter sp. 638
Ent638_1263 hutU -58 4.9 GGGGTTGTCTATACAAGTAT
Ent638_1260 hutI -4 4.9 ATAAATGTCTATACAACTCA
Erwinia amylovora ATCC 49946
EAM_1254 hutH -83 4.2 AGACAAGAATATACAAATGT
EAM_1254 hutH -93 5 GTAGTTGTATAGACAAGAAT
EAM_1255 hutC -202 5 ATTCTTGTCTATACAACTAC
EAM_1257 hutF -38 4.6 GTATATGTATATACAACCTC
EAM_1258 hutI -63 4.6 GAGGTTGTATATACATATAC
EAM_1255 hutC -212 4.2 ACATTTGTATATTCTTGTCT
Yersinia pestis KIM
y2338 hutF -33 5.8 GTATATGTATATACAAGTAA
y4038 hutU -72 5.9 GTACTTGTCTATACAAGTAT
y2339 hutC -80 5.8 TTACTTGTATATACATATAC
y2340 hutI -113 5.9 ATGATTGTATATACAAGTTG
Serratia proteamaculans 568
Spro_2079 hutF -117 5.3 GTATATGTATATACAACTAA
Spro_0805 hutU -20 6.3 ATGCTTGTACATACAAGTAT
Spro_2077 hutI -51 5.9 TTAATTGTATATACAACCAT
Spro_2078 hutC -80 5.3 TTAGTTGTATATACATATAC
Photorhabdus luminescens subsp. laumondii TTO1
plu3197 hutI -104 5.9 ATAAATGTATATACAATTAA
plu3193 hutU -69 4.6 TCTATTGAATATACATGTAT
plu3193 hutU -59 6 ATACATGTATATACAACTAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD