Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Zur in Rhodospirillales

Properties
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur - Rhodospirillales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Rhodospirillum rubrum ATCC 11170
Rru_A3702 znuC -199 6 AAAATGTGATGTTATAACGTTTT
Magnetospirillum magnetotacticum MS-1
Magn03000731 znuA4 -52 5.1 GCGATGTGATAATGTTACATTAT
Magn03007851 zur -87 6.9 GAAATGTTATAATATAACATATC
Magn03007850 znuA3 -53 6.8 GATATGTTATATTATAACATTTC
Magnetospirillum magneticum AMB-1
amb2308 znuA3 -53 6.4 GATTTGTTATATTATAACATTCC
amb2309 zur -36 6.4 GGAATGTTATAATATAACAAATC
Azospirillum sp. B510
AZL_d00760 znuC3 -129 5.3 GTCACGTTATAACGTAACATGTC
AZL_004800 PF08856 -54 6 TGTACGTTATGATATAACATTAC
AZL_d00770 znuA3 -94 5.9 GACATGTTACGTTATAACGTGAC
Rhodospirillum centenum SW
RC1_3161 znuA3 -70 5.9 CAAATGTTATAATATAACGATCT
RC1_3938 omr2 -65 5.2 GATACGTTATAACATCACGTACC
RC1_3160 znuC3 -75 5.8 AGATCGTTATATTATAACATTTG
Gluconacetobacter diazotrophicus PAl 5
Gdia_1959 zur -105 5.6 ACTATGTTATAATGTAACAAATA
Gdia_1958 znuA2 -75 6 TATTTGTTACATTATAACATAGT
Gdia_1456 omr -89 4.6 GAAACGTTATATCATACGGTTTA
Acetobacter pasteurianus IFO 3283-01
APA01_22640 zur -105 5.7 GCAATGTAATACTATTACATTTT
APA01_04190 omr -66 5.9 GTAATGTTATAGTGTTACATAAT
APA01_22630 znuA2 -42 5.8 AAAATGTAATAGTATTACATTGC
Gluconobacter oxydans 621H
GOX0562 omr1 -178 5.6 ATTATGTTATATCATAACAGTTC
GOX2212 yciC -73 6.1 CGATTGTTATGTTATAACATAAT
GOX2213 PF08856 -46 5.4 TGATCATTATGTTATAACATAAC
GOX0561 omr -80 6.4 GAACTGTTATGATATAACATAAT
GOX1044 znuA2 -50 5.3 GATGTGTTACTTTATAACGCTAC
Granulibacter bethesdensis CGDNIH1
GbCGDNIH1_1545 yciC -57 6.4 TAAACGTTATGTTATAACATAAC
GbCGDNIH1_1210 znuC -172 5.9 TATATGTTATAACATAACACAAT
GbCGDNIH1_0784 PF08856 -63 6.1 TGTTTGTTATGTTATAACATAAC
GbCGDNIH1_1357 omr -28 6.1 AACATGTCATGTTATAACATAAC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD