Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Zur in Rhodobacterales

Properties
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur - Rhodobacterales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Rhodobacter sphaeroides 2.4.1
RSP_3117 zinT -62 5.9 GATATGTAATAACATATCATATA
RSP_3571 znuA -55 5.4 GACGCGTTATGATATAACGTAAT
RSP_3569 zur -24 5.7 ATTACGTTATATCATAACGCGTC
Paracoccus denitrificans PD1222
Pden_1338 yciC -33 5.7 GTAACGTAATAACATTACATTTA
Pden_4140 znuA -83 5.4 ATGATGTTATATCGTTACATTTT
Pden_4139 zur -49 5.3 TTTATGTTATATCGTAACCCGTC
Jannaschia sp. CCS1
Jann_0312 znuA -61 5.4 GTCATGTTATTTCATATCAGTTA
Jann_0313 zur -18 5.2 TAACTGATATGAAATAACATGAC
Rhodobacterales bacterium HTCC2654
RB2654_20868 znuA -59 5.2 GATGCGTTATGATATTACAGATA
RB2654_20873 zur -35 5.5 TATCTGTAATATCATAACGCATC
Oceanicola granulosus HTCC2516
OG2516_06072 znuA -63 5.1 GGGTTGTTACGTTATAACATCTC
OG2516_06067 zur -35 5.7 GAGATGTTATAACGTAACAACCC
Loktanella vestfoldensis SKA53
SKA53_01411 znuA -63 5.7 GCCTTGTTATGATATAACATATC
SKA53_01416 zur -29 6 GATATGTTATATCATAACAAGGC
Oceanicola batsensis HTCC2597
OB2597_14476 znuA -30 5.2 GCAATGTTATCTTATAACAGGAA
OB2597_20976 trxR -116 5 GTAACGTGATATCATAACCACAT
OB2597_14481 zur -55 5.3 TTCCTGTTATAAGATAACATTGC
Roseovarius nubinhibens ISM
ISM_14180 znuA -115 5.5 GATATGTTATATTATCTCATCTA
ISM_00325 yciC -71 5.4 GTGATGTTATACTATAACAGATT
ISM_05645 zinT -34 5.2 GCTACGTTATATCATAACTACTT
ISM_14175 zur -54 5.6 TAGATGAGATAATATAACATATC
Roseovarius sp. 217
ROS217_23037 znuA -32 5.3 TGAATGTTATGATATCACATATG
ROS217_23042 zur -98 5.5 CATATGTGATATCATAACATTCA
Sulfitobacter sp. EE-36
EE36_13038 znuA -64 5.3 GTGTTGATATGTTATAACGTGTG
EE36_11254 zinT -54 6.1 GTTACGTTATAACATAACGAATC
EE36_13033 zur -47 5.5 CACACGTTATAACATATCAACAC
Silicibacter TM1040
TM1040_3616 znuA -36 5.3 ATAACGTTATGATATAACACCAG
TM1040_0201 zinT -36 5.6 AACGTGTTATAACATAACGAATC
TM1040_0080 yciC -38 5.4 TGATTGTTATCTTATAACATTTC
TM1040_3615 zur -86 5.5 CTGGTGTTATATCATAACGTTAT
Silicibacter pomeroyi DSS-3
SPO0987 znuA -65 5.2 GGCTTGATATGTTATAACATCCC
SPO0986 zur -45 5.6 GGGATGTTATAACATATCAAGCC
Roseobacter sp. MED193
MED193_01520 znuA -66 5.6 GAGATGTTATAAAATTACATGAG
MED193_01515 zur -111 5.6 CTCATGTAATTTTATAACATCTC
Hyphomonas neptunium ATCC 15444
HNE_1973 omr -44 5.4 GTAATGCAATATTATTACATTAC
Oceanicaulis alexandrii HTCC2633
OA2633_05989 omr -52 5.7 GTGACGTTATGACATTACGTAAC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD