Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Zur in Rhizobiales

Properties
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur - Rhizobiales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Sinorhizobium meliloti 1021
SMc04244 znuC2 -114 5.6 GCGTTGTTATGTTATTACATCAA
SMc03799 yciC -101 5.3 GCTATGTTACGTTATTACGTTTA
SMc04245 znuA2 -86 5.5 TTGATGTAATAACATAACAACGC
Rhizobium sp. NGR234
NGR_c17640 znuC2 -8 5.3 TGCACGTAATGTTATTACATCAA
NGR_c17650 znuA2 -204 5.4 TTGATGTAATAACATTACGTGCA
Rhizobium leguminosarum bv. viciae 3841
RL3177 znuC2 -81 5.8 CAATTGTTATGTTATTACATCAA
RL1047 znuC -158 5.4 TAACCGTAATGTTATTACATTGT
RL4148 yciC -124 5.3 GCGATGTGATCTTATAACATTAT
RL3178 znuA2 -89 5.7 TTGATGTAATAACATAACAATTG
RL3179 yciC2 -44 6.2 CAAATGTAATGATATAACATAAA
Rhizobium etli CFN 42
RHE_CH02711 znuC2 -81 5.4 CGAGTGTTATGTTATTACATTGA
RHE_PF00158 zinT -74 5.4 GTAATGTTATTACATTACGGACT
RHE_CH00969 znuC -174 5.4 TAATCGTTATAACATAACAGTAA
RHE_CH03625 yciC -122 5.3 GCAATGTGATCTTATAACATATA
RHE_CH02712 znuA2 -43 5.5 TCAATGTAATAACATAACACTCG
RHE_CH02713 yciC2 -39 6 GACATGTAATGATATAACATTAA
Agrobacterium tumefaciens str. C58 (Cereon)
Atu3181 yciC2 -120 5.9 CATATGTAATGTTATTACGTTAC
Atu1521 znuA2 -45 5.6 TAAATGTAATAACATAACTATAC
Atu1520 znuC2 -82 5.5 GTATAGTTATGTTATTACATTTA
Atu1049 zinT -58 6.1 GAAATGTAATGTTATTACGTTAC
Atu4502 yciC -142 5.4 ATAACGTTATTTCATAACAAAAT
Atu3180 znuC -203 5.8 GTAACGTAATAACATTACATATG
Atu3180 znuC -91 5.9 TTAATGTTATTTCATTACATATT
Atu3180 znuC -61 5.8 CGAATGTAATAACATTACATATC
Atu3181 yciC2 -262 5.9 GATATGTAATGTTATTACATTCG
Mesorhizobium sp. BNC1
Meso_4006 znuA2 -105 5.6 CAAGTGTAATGTCATAACGTTTA
Meso_4005 znuC2 -77 5.5 TAAACGTTATGACATTACACTTG
Mesorhizobium loti MAFF303099
mll8315 znuC -69 5.8 CTAATGTAATAACATCACATATC
Brucella melitensis 16M
BMEII0177 znuC2 -183 5.4 GATATGTTATTTTATTACGCAAA
BMEII0178 znuA2 -106 5.3 CAGACGTTATAGCATAACGTAAT
Bartonella quintana str. Toulouse
BQ01790 znuC -56 6.2 CAAATGTTATATTATTACATAAC
Rhodopseudomonas palustris CGA009
RPA4384 PF11162 -44 5.2 GCAATGTTACTTTATAACATCGG
RPA0858 znuC -248 5.1 ATAATGTTATAATGTAACAGGTT
RPA1462 yciC2 -65 5.8 TTTATGTAATGTTATAACGTTTC
Bradyrhizobium japonicum USDA 110
bll2461 PF11162 -3 5.3 GCGATGTTACATTATAACATCGC
bll7771 znuC -259 5.9 GTAATGTTATAATATAACGTCCA
Bradyrhizobium sp. BTAi1
BBta_2267 PF11162 -75 4.6 GCGATGTTACTTTGTAACAATGG
BBta_2203 yciC -87 6 ATGATGTTATGTTATAACATAAC
BBta_2276 yciC -260 5.6 ATTTTGTAATGTTATAACATCAC
BBta_1339 znuC -271 5.6 ATGATGTTATAATGTAACATTAT
Nitrobacter winogradskyi Nb-255
Nwi_2630 PF11162 -65 5.3 CAGGCGTTATATTATAACATCCG
Nwi_0914 znuC -252 5.5 GTGATGTTATAATATAACGGTCG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD