Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Zur in Comamonadaceae

Properties
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur - Comamonadaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Acidovorax avenae subsp. citrulli AAC00-1
Aave_2813 zur -50 6.8 ATAATGCAACACGATTGCATTAA
Delftia acidovorans SPH-1
Daci_3951 zur -72 6.9 ATAATGCAACCCGGTTGCGATAA
Polaromonas naphthalenivorans CJ2
Pnap_1145 zur -77 6.5 ATAATGCAACCTGATTGCGATAG
Pnap_1145 zur -45 6.6 GTAACGCAACTGAATTGCATTAA
Pnap_1144 znuC -251 6.5 TTAATGCAATTCAGTTGCGTTAC
Pnap_1144 znuC -219 6.1 CTATCGCAATCAGGTTGCATTAT
Polaromonas sp. JS666
Bpro_1677 zur 27 7 ATAATGCAACTAGATTGCGTTAT
Rhodoferax ferrireducens DSM 15236
Rfer_2053 znuC -251 6.6 ATATCGCAATTCAGTTGCATTAT
Rfer_2054 zur -81 6.9 ATAATGCAACTGAATTGCGATAT
Rfer_2054 zur -55 6.8 TTAACGCAACTCAATTGCAATAA
Rfer_2053 znuC -277 6.4 TTATTGCAATTGAGTTGCGTTAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD