Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Zur in Burkholderia

Properties
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur - Burkholderia
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Burkholderia pseudomallei K96243
BPSS1850 omr -87 6.1 ATATTGATACGTTATATCGTTTC
BPSS1850 omr -199 4.8 GAAATGATATAACATATCGATAC
BPSL0825 zur -51 6 GCGCGGATACGTTATATCATCAC
BPSL2724 omr1 -303 5.8 CGGATGATATGTTATATCATCGT
Burkholderia mallei ATCC 23344
BMA0329 zur 9 6 GCGCGGATACGTTATATCATCAC
BMA2036 omr1 -301 5.8 CGGATGATATGTTATATCATCGT
BMAA0251 omr -87 6.1 ATATTGATACGTTATATCGTTTC
BMAA0251 omr -199 4.8 GAAATGATATAACATATCGATAC
Burkholderia sp. 383
Bcep18194_A5930 zur -53 6.1 ACGGCGATACGTTATATCATCGC
Bcep18194_A4489 omr1 -209 5.3 GAATTGATATTTTGTATCATCTG
Bcep18194_B1524 omr -182 5.7 GAAATGATATAACATATCATTTC
Bcep18194_B0316 yciC -8 6.1 GAAATGATATGTTATATCGTTGC
Burkholderia cepacia AMMD
Bamb_3871 omr -217 5.8 GAGATGATATAACATATCATTTC
Bamb_2647 zur -54 6.3 AGGGAGATACGTTATATCATCGC
Burkholderia vietnamiensis G4
Bcep1808_4992 omr -179 4.9 GAAATGATATAACGTATCATCTT
Bcep1808_2713 zur -53 6.3 GGCGAGATACGTTATATCATCGC
Bcep1808_4992 omr -74 5.1 ACGATGCAACAATATATCGTTTC
Burkholderia glumae BGR1
bglu_2g16600 omr -197 5.9 AAAATGATACGTTATATCGTGTC
bglu_1g29530 zur -53 5.5 GGCTGGATACGTTATATCATCCG
Burkholderia xenovorans LB400
Bxe_B0900 omr2 -165 4.9 TGAATGTAATGATATAACATTCC
Bxe_A0718 zur -84 6.2 ATCGAGATACGTTATATCATTGC
Burkholderia phymatum STM815
Bphy_0488 zur -59 6 TTCGAGATACGTTATATCATTGC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD