Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Zur in Moraxellaceae

Properties
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur - Moraxellaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Acinetobacter sp. ADP1
ACIAD1741 yciC -128 6.4 TATATGTTACATTATAACATAAC
ACIAD0176 zur -97 6.1 CTTGTGTTATATTATAACAAATT
ACIAD1328 ACIAD1328 -43 5 GGAATGTTATAGTATTTGAAATT
ACIAD0177 znuA -36 5.7 AATTTGTTATAATATAACACAAG
ACIAD1742 null -44 5.1 CCAATGTTATAATGTAACAGTTA
ACIAD0612 omr1 -25 5.5 AAATAGATATATTATAACGTAAC
ACIAD0611 omr1 -64 6.2 GCAATGTTATAATATTACAAAAA
ACIAD0425 rpmE2 -54 6.2 AAAATGAAATAATATAACATTAC
ACIAD1003 omr3 -54 6.2 GTAATGTTATAGTATTACAATTA
ACIAD1420 can -101 6.3 TATTTGTTATGTTATAACATAAC
ACIAD0507 tonB -253 5.7 AAAGTATTATGTTATAACATAAT
Acinetobacter baumannii AB0057
AB57_3864 yciC -77 6.4 GTTATGTTATAACATAACATTAT
AB57_0184 zur -111 5.9 AGCATGTTATAATATAACAAAGT
AB57_0185 znuA -51 5.8 ACTTTGTTATATTATAACATGCT
AB57_3926 omr1 -41 6 TAAGTGTTATATTATAATATAAC
AB57_3396 omr1 -51 6.7 GAAATGTTATAATATAACAAAAC
AB57_0468 rpmE2 -54 6 TGAGTGTTATGTTATAACATTTC
AB57_0135 omr3 -54 5.9 GTAACGTTATACTATTACATTTA
Psychrobacter arcticum 273-4
Psyc_1790 Psyc_1790 -165 5.7 AAATTGATATATTATAAAATAAT
Psyc_2033 zur -187 6.8 ATTATGTTATACTATAACATAAT
Psyc_2032 znuA -83 6.8 ATTATGTTATAGTATAACATAAT
Psychrobacter sp. PRwf-1
PsycPRwf_1910 znuA2 -100 6.4 TTATTGTTATAATATAACATACT
PsycPRwf_0184 zur -408 5.8 GATATGTTATACTATAACTAATA
PsycPRwf_2339 omr2 -97 5 AAAACGTTATGTTATACTATAAC
PsycPRwf_2339 omr1 -92 6.8 GTTATGTTATACTATAACATAAC
PsycPRwf_2340 omr1 -86 6.8 GTTATGTTATAGTATAACATAAC
PsycPRwf_1926 PsycPRwf_1926 -121 6.6 TTAATGTTATGTTATAACATAAT
PsycPRwf_0185 znuA -142 6.1 TATTAGTTATAGTATAACATATC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD