Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Zur in Oceanospirillales/Alteromonadales

Properties
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur - Oceanospirillales/Alteromonadales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Hahella chejuensis KCTC 2396
HCH_00656 zbp -70 5.7 GTTTCGTTATGTTATAACATAAA
HCH_02800 yciC -59 6.2 GTTTTGTTATGTTATAACATTTT
HCH_02942 znuA -84 6.3 GATATGTTACATCATAACATTTT
HCH_02413 znuA -64 6.3 ATAATGTTATGTTATAACCTTTC
HCH_00537 zur -80 5.3 CAATTGTTATAACATTACACTTC
HCH_02943 null -66 4.9 AAAAAGATATGATGCAACATATC
HCH_01703 zur2 -211 5.7 AAAAAGATATGATATAACGTATC
HCH_01703 zur2 -206 5.2 GATATGATATAACGTATCTTTAT
Marinobacter aqueolei
Maqu_3429 zbp -39 5.6 AAAATGTTATAACATATCAAATA
Maqu_1892 znuA -48 6.3 ATATTGTTATATTATAACGTTTC
Marinobacter sp. ELB17
MELB17_02870 zbp -34 5.9 AAGATGTTATAACATAACTTTAC
MELB17_08596 znuA -68 5.8 GTTATGTAATATTATAACATTCT
MELB17_12891 znuA -60 5.7 GCAATGTTATAACATAACGTTCA
MELB17_12886 znuC -102 5.5 TGAACGTTATGTTATAACATTGC
Oceanobacter sp. RED65
RED65_11939 PF08856 -47 5 GATATAATATATCATATCTTTTA
RED65_11939 PF08856 -52 5.4 CAAAAGATATAATATATCATATC
Oceanospirillum sp. MED92
MED92_15318 zbp -28 5.7 TTGTTGTTATATTATAACTTTTA
MED92_08311 PF08856 -44 5.7 GTTATGTTATATTGTATCTTTTT
MED92_05848 znuA -38 5.7 TTTGTGTTATATTGTAACTTTAA
MED92_05843 zur -43 5.6 TTAAAGTTACAATATAACACAAA
MED92_02998 null -35 5.9 ATATTGTTATGGTATAACATTTA
MED92_02998 null -138 5.3 GCAATGTTATAATATAGCAATTA
MED92_08311 PF08856 -49 5.1 TTAAAGTTATGTTATATTGTATC
MED92_02993 pyrC2 -152 5.7 TAAATGTTATACCATAACAATAT
MED92_02993 pyrC2 -49 5.5 TAATTGCTATATTATAACATTGC
Marinomonas sp. MWYL1
Mmwyl1_1446 yciC -39 6.6 GAAATGTTATATCATAACATTTT
Mmwyl1_0929 PF08856 -18 5.8 AAAATGTTATAACGTAACATGTT
Mmwyl1_0929 PF08856 -23 4.6 TTTGTAAAATGTTATAACGTAAC
Mmwyl1_0291 null -51 5.2 TACTTGTTATATCATAACAAAAT
Mmwyl1_1122 null -40 5.9 GTATTGTTACGTTATAACATTAA
Saccharophagus degradans 2-40
Sde_0060 znuA -80 6 GTTATGTTATCATATAACACTTT
Sde_0059 zur -51 6.1 AAAGTGTTATATGATAACATAAC
Sde_1980 yciC -184 5.6 ATAATGATATCATATATCATATC
Teredinibacter turnerae T7901
TERTU_2263 yciC -119 5.5 ATAATGATATGGTATATCATAAC
TERTU_0054 znuA -67 6.1 GTTATGTTATCATATAACGTTTA
TERTU_0053 zur -51 6 TAAACGTTATATGATAACATAAC
TERTU_2263 yciC -114 6 GATATGGTATATCATAACGTTAC
Cellvibrio japonicus Ueda107
CJA_3465 yciC -46 6.1 AATGTGTTATGTTATAACATATT
CJA_3480 znuA -3 5.4 GTTATGTTACTCTATAACCTTTC
CJA_3482 zur -53 5.3 GAAAGGTTATAGAGTAACATAAC
Chromohalobacter salexigens DSM 3043
Csal_0192 yciC -90 5.9 AGAATGTTATGGTATAACATATC
Csal_0187 zinT -70 5.3 AGAAAGATATGTTATAACGTATT
Csal_0188 znuA -63 5.9 TATATGTTATAACATAACTCTTT
Csal_0189 znuC -56 5.9 AAAGAGTTATGTTATAACATATA
Reinekea sp. MED297
MED297_11280 znuA -61 5.6 GTTATGATACATCATATCATTTA
MED297_11285 znuC -124 5.4 TAAATGATATGATGTATCATAAC
MED297_11285 znuC -119 5.2 GATATGATGTATCATAACAAATA
MED297_00400 zur2 -77 5.9 TTAATGATATATCATATCATTTA
Alcanivorax borkumensis SK2
ABO_1680 dksA2 -34 5.7 GCAATGTTATAACATAACATGAA
ABO_1681 null -51 4.9 GTTATGTTATAACATTGCATCAA
ABO_1681 null -56 5.7 TTCATGTTATGTTATAACATTGC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD