Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator NrtR in Rhodobacterales

Properties
Regulator family: NrtR
Regulation mode: repressor
Biological process: NAD biosynthesis
Effector: Adenosine diphosphate ribose
Regulog: NrtR - Rhodobacterales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Roseobacter sp. MED193
MED193_19424 nrtR -38 6.4 TTATATCTAAATAGGTAATAA
MED193_19424 nrtR -23 6.4 TAATAACTAAATAGGATATAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD