Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator NrtR in Rhizobiales

Properties
Regulator family: NrtR
Regulation mode: repressor
Biological process: NAD biosynthesis
Effector: Adenosine diphosphate ribose
Regulog: NrtR - Rhizobiales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Rhizobium etli CFN 42
RHE_PF00026 nrtX -81 5.7 TTAGTTGACATTTCTCACTAA
RHE_PF00027 nrtR -68 5.7 TTAGTGAGAAATGTCAACTAA
RHE_PF00027 nrtR -46 5.9 TTAGTTGAAGATTTACACTAA
RHE_PF00026 nrtX -103 5.9 TTAGTGTAAATCTTCAACTAA
Bradyrhizobium sp. BTAi1
BBta_5113 nrtR -83 5.3 TAAGTGTGTCACGACAACTAA
BBta_5113 nrtR -61 5.9 TAAGTTGGACAGTACAACTAA
BBta_5114 nrtX -68 5.9 TTAGTTGTACTGTCCAACTTA
BBta_5114 nrtX -46 5.3 TTAGTTGTCGTGACACACTTA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD