Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator NrtR in Comamonadaceae

Properties
Regulator family: NrtR
Regulation mode: repressor
Biological process: NAD biosynthesis
Effector: Adenosine diphosphate ribose
Regulog: NrtR - Comamonadaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Acidovorax avenae subsp. citrulli AAC00-1
Aave_0977 pncA -63 5.1 TTAGTTGCACAAATAAACTAA
Delftia acidovorans SPH-1
Daci_5758 nrtX -58 5.8 TAAGTTGCACTATGCAACCCA
Daci_5758 nrtX -35 6 CGAGTTGTACAGAACAACTTA
Daci_5757 nrtR -74 5.7 TAAGTTGTTCTGTACAACTCG
Daci_5757 nrtR -51 6 TGGGTTGCATAGTGCAACTTA
Polaromonas naphthalenivorans CJ2
Pnap_3720 pncA -48 6.2 AAGGTTGTTCAGTACAACCTA
Pnap_3720 pncA -73 5.7 AAGGTTGTATTATGCAACCCA
Pnap_3721 nrtR -104 5.9 TAGGTTGTACTGAACAACCTT
Pnap_3721 nrtR -79 5.8 TGGGTTGCATAATACAACCTT
Variovorax paradoxus S110
Vapar_6282 pncA -61 6 ATGGTTGTACAGTGCAACCAA
Vapar_6282 pncA -38 6.2 AGAGTTGCACAGTACAACTAA
Vapar_6281 nrtR -41 6 AGAGTTGTTCTGTACAACCCA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD