Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator NrtR in Moraxellaceae

Properties
Regulator family: NrtR
Regulation mode: repressor
Biological process: NAD biosynthesis
Effector: Adenosine diphosphate ribose
Regulog: NrtR - Moraxellaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Acinetobacter sp. ADP1
ACIAD0964 prs -60 6.2 AAATTGTCTTTATGCCACTAT
ACIAD0964 prs -35 5.3 TTAATGGCTTTATGCCACTAT
Acinetobacter baumannii AB0057
AB57_2115 prs -58 5.8 ATAGTGGCTTTGTGCCACTAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD