Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator NrtR in Pseudomonadaceae

Properties
Regulator family: NrtR
Regulation mode: repressor
Biological process: NAD biosynthesis
Effector: Adenosine diphosphate ribose
Regulog: NrtR - Pseudomonadaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Pseudomonas aeruginosa PAO1
PA4917 nadD -69 5.4 ATAATTCATCACGTGAAATAA
PA4918 pncA -61 5.4 TTATTTCACGTGATGAATTAT
Pseudomonas entomophila L48
PSEEN2060 nrtR -113 5.3 ATAATTCACCTGGTGCATTAA
PSEEN2059 pncA -51 5.3 TTAATGCACCAGGTGAATTAT
Pseudomonas fluorescens Pf-5
PFL_2466 pncA -48 5.5 AAAGTACATGACATATACTTT
PFL_2465 nadD -35 5.4 AAGGTACACGTCATGTACCAA
PFL_2465 nadD -156 5.5 AAAGTATATGTCATGTACTTT
PFL_2466 pncA -169 5.4 TTGGTACATGACGTGTACCTT
Pseudomonas mendocina ymp
Pmen_1413 nrtR -109 5.3 ATATTTCATCTGATGAAATAT
Pmen_1412 pncA -52 5.3 ATATTTCATCAGATGAAATAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD