Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator NrtR in Oceanospirillales/Alteromonadales

Properties
Regulator family: NrtR
Regulation mode: repressor
Biological process: NAD biosynthesis
Effector: Adenosine diphosphate ribose
Regulog: NrtR - Oceanospirillales/Alteromonadales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Hahella chejuensis KCTC 2396
HCH_04328 nrtX -46 5.6 TTGGTGGCTTTGAGCCACTAT
HCH_06995 pnuC -103 6.2 TTAGTGGCATTAGGCCACTAA
HCH_06993 nadM -126 6 TTAGTGTCATTATGCCACTAT
HCH_06996 nrtR -41 6 TTAGTGGCCTAATGCCACTAA
Marinobacter sp. ELB17
MELB17_12286 pncB -75 4.7 TCTGTCAAATCAATTGACACA
MELB17_12281 nrtR -73 4.7 TGTGTCAATTGATTTGACAGA
MELB17_12281 nrtR -116 4.5 TTAGTCAATTCATTTGACGGT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD