Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator NrtR in Psychromonadaceae/Aeromonadales

Properties
Regulator family: NrtR
Regulation mode: repressor
Biological process: NAD biosynthesis
Effector: Adenosine diphosphate ribose
Regulog: NrtR - Psychromonadaceae/Aeromonadales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Aeromonas hydrophila subsp. hydrophila ATCC 7966
AHA_4211 pncA -44 5.9 TTGGTAGATAATATCACACGA
AHA_4210 nrtR -52 5.9 TCGTGTGATATTATCTACCAA
Aeromonas salmonicida subsp. salmonicida A449
ASA_0115 nrtR -52 5.9 TCGTGTGATATTATCTACCAA
ASA_0114 pncA -43 5.9 TTGGTAGATAATATCACACGA
Tolumonas auensis DSM 9187
Tola_0586 pncB -109 5.4 TTGGTATCTTAAAGGAACCAA
Tola_0585 nadD -96 5.4 TTGGTTCCTTTAAGATACCAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD