Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator NrtR in Enterobacteriales

Properties
Regulator family: NrtR
Regulation mode: repressor
Biological process: NAD biosynthesis
Effector: Adenosine diphosphate ribose
Regulog: NrtR - Enterobacteriales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Proteus mirabilis HI4320
PMI2395 nrtR -115 6.6 ATATTGTCTTATGGACACTAT
PMI2395 nrtR -80 5.6 TTAGTGTCTTTATGACAAAAT
PMI2395 nrtR -140 5.1 TTAGTGTCCTTATGACATTAA
PMI2396 nrtX -33 5.1 TTAATGTCATAAGGACACTAA
PMI2396 nrtX -58 6.6 ATAGTGTCCATAAGACAATAT
PMI2396 nrtX -93 5.6 ATTTTGTCATAAAGACACTAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD