Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator NadQ in Rhizobiales

Properties
Regulator family: NadQ
Regulation mode: repressor
Biological process: NAD biosynthesis
Effector:
Regulog: NadQ - Rhizobiales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Sinorhizobium meliloti 1021
SMc02601 nadA -58 6.7 TTATGCTCAGATTGAGCATAA
Rhizobium sp. NGR234
NGR_c08490 nadA -54 6.8 TTATGCTCATATTGAGCATAA
Rhizobium leguminosarum bv. viciae 3841
pRL110617 nadA -34 6.2 ATATGCTCAAACAGAGCATAA
pRL110617 nadA -68 5.6 ATATGCTCACGGTGAGAATAT
Rhizobium etli CFN 42
RHE_PE00441 nadA -68 5.6 ATATGCTCATAGCGAGAATAT
RHE_PE00441 nadA -34 6.3 ATATGCTCAAATCGAGCATAA
Agrobacterium tumefaciens str. C58 (Cereon)
Atu4098 nadA -2 5.9 ATATGCTCACAATGAGAATAT
Mesorhizobium sp. BNC1
Meso_2557 nadA -60 5.2 TTATGCTCAGCGCAAGCATAT
Meso_2557 nadA -34 6.1 ATATGCTCAATCGGAGCATAA
Mesorhizobium loti MAFF303099
mll5835 nadA1 -32 5.3 TTATAATCAGATGGACTATAA
mll9104 nadA2 -58 5.3 TTATAGTCACAAAGATTATAA
mll9104 nadA2 -32 5.1 TTATAATCGTATAGACTATAA
mll5835 nadA1 -58 5.2 TTATAGTCACAACGATTATAT
Rhodopseudomonas palustris CGA009
RPA1055 nadA -186 5.9 TTATGCTCTGAATGAGGATAA
RPA1055 nadA -48 6.3 ATATGCTCAAACTGAGTATAT
Bradyrhizobium japonicum USDA 110
bll2542 nadA -117 5.9 ATTTACTCAGATTGAGCATAT
bll2542 nadA -42 6.5 ATATACTCACATTGAGCATAA
Bradyrhizobium sp. BTAi1
BBta_4757 nadA -111 5.7 TTATGCTCAGGATAAGTATAA
BBta_4757 nadA -84 5.9 TTATGCTCACGGAGAGTATAA
Nitrobacter winogradskyi Nb-255
Nwi_2424 nadA -46 6.3 TTATACTCAATATCAGTATAA
Xanthobacter autotrophicus Py2
Xaut_1183 nadA -52 5.9 TTATGCTCAGTATAAGCATAT
Xaut_1183 nadA -24 5.9 ATATGCTCAAACTGAGTATAG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD