Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator NadQ in Comamonadaceae

Properties
Regulator family: NadQ
Regulation mode: repressor
Biological process: NAD biosynthesis
Effector:
Regulog: NadQ - Comamonadaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Comamonas testosteroni KF-1
CtesDRAFT_2977 nadC -91 5.7 TAATGCTCAGATTTAGCATAA
CtesDRAFT_2977 nadC -11 5.8 AAATACTCAAAATGAGCATTA
CtesDRAFT_2575 nadA -52 6.2 TAATACTCAGATTGAGTATAA
Delftia acidovorans SPH-1
Daci_1541 nadC -11 6.2 ATATACTCAAAATGAGCATTA
Daci_2150 nadA -67 6.2 TAATACTCAAATTGAGCATAT
Daci_1541 nadC -81 5.5 TTATGCTCGTATCTAGCATAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD