Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator NsrR in Moraxellaceae

Properties
Regulator family: Rrf2
Regulation mode: repressor
Biological process: Nitrosative stress response
Effector: Nitric oxide
Regulog: NsrR - Moraxellaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Acinetobacter sp. ADP1
ACIAD3226 hmp -72 6.4 AGATGCATTGCAAATACATCT
ACIAD3226 hmp -47 5.4 AAATGTATTTTGAATATATCT
Acinetobacter baumannii AB0057
AB57_3535 hmp -49 6.7 AGATGTATTTTAAATACATCT
Psychrobacter sp. PRwf-1
PsycPRwf_0670 hmp -142 6.9 AGATTCATTTGAAATGAATCT
PsycPRwf_1520 norB -188 6.5 ACATTCATTTTAAATGAATGT
PsycPRwf_1520 norB -53 6.8 ACATTCATTTTAAATGAATCT
PsycPRwf_0765 nnrS -135 6.3 ACATTCATTATAAATACATCT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD