Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator NsrR in Oceanospirillales/Alteromonadales

Properties
Regulator family: Rrf2
Regulation mode: repressor
Biological process: Nitrosative stress response
Effector: Nitric oxide
Regulog: NsrR - Oceanospirillales/Alteromonadales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Saccharophagus degradans 2-40
Sde_0102 nnrS -82 4.9 AGATGTAATATACATGCATCT
Sde_0102 nnrS -56 5.3 AGATGCATAATAAATGTATCT
Cellvibrio japonicus Ueda107
CJA_1546 norB -88 5.4 AGATTCATTTATTTTGCATCT
CJA_1547 DUF454 -50 5.4 AGATGCAAAATAAATGAATCT
Reinekea sp. MED297
MED297_07531 nsrR -44 5.5 AGATGTATATTAAATGCATCT
MED297_17612 nsrR -193 4.1 AAATGTAATTTAATTACATAA
Alcanivorax borkumensis SK2
ABO_2120 nsrR -27 4.1 AGATACTCATTTTTTGGAGGT
ABO_2119 hmp -84 4.1 ACCTCCAAAAAATGAGTATCT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD