Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator NsrR in Psychromonadaceae/Aeromonadales

Properties
Regulator family: Rrf2
Regulation mode: repressor
Biological process: Nitrosative stress response
Effector: Nitric oxide
Regulog: NsrR - Psychromonadaceae/Aeromonadales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Psychromonas ingrahamii 37
Ping_0631 nsrR -49 5.2 AGATGTAAAATAAATACATCT
Ping_2905 hmp -63 4.2 ATATGCATTTAAGATGCCTCT
Ping_2905 hmp -33 4.5 AGAAGTATTTTAAATGCATAT
Psychromonas sp. CNPT3
PCNPT3_03586 hmp -36 5 ACATGTATTTTAAATGCAACT
PCNPT3_03591 nsrR -86 5 AGTTGCATTTAAAATACATGT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD