Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator NsrR in Alteromonadales

Properties
Regulator family: Rrf2
Regulation mode: repressor
Biological process: Nitrosative stress response
Effector: Nitric oxide
Regulog: NsrR - Alteromonadales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Pseudoalteromonas haloplanktis TAC125
PSHAa2417 norB -191 5.4 ACATGCATTTTGTTTGCATGT
PSHAa2419 nsrR -132 5.4 ACATGCAAACAAAATGCATGT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD