Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Cobalamin in Bacteroidaceae

Properties
Regulator family: RF00174
Regulation mode:
Biological process: Cobalamin biosynthesis
Effector: Adenosylcobalamin
Regulog: Cobalamin - Bacteroidaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bacteroides thetaiotaomicron VPI-5482
BT1998 nrdD -214 94.8 TCTTTGTATCCGATTTCGGAACTAAAAAGAGGTTTAGTCAATGAGGGAACGCTGTGCAAATCGGCGACAGTACCCGCTGCTGTAATTCTCTGTGAATCCGCACACTATGTCACTGCATCGGCAGATGTGGGAAGGCGCTGCGGGGGAGGGATAAGTCAGAAGACCTGCCGGAGTCAAATAAACATATTA
BT1915 pccC -341 86.5 TCTTTGCCCCCCGAAATGGTTCGGAGTCCGTGTCCAACGGACAACGATTAAAAGGGAATCGGGTGTAAATCCCGTACAGTCCCGCTGCTGTGAAGCTCTATACAATGTCTTATTAATGAACTAATTTATCGCCACTGATGTTATTTCGGGAAGGCACTATAAGACAAGAGTCAGTCAGAAGACCTGCCACTTCGCGTAAAGCGTTCTT
BT1486 null -286 102.6 ATCTTTGTCCCCGCATTGGTTTGCGACTCTCATCACGAGGGAAGCGATTAAAAGGGAATCAGGTGTAAATCCTGAACAGTCCCGCTGCTGTAAGTTCCATAGATATGTTGCGAGCAATCTACTCAAAGCCACTGGAAAGAAAATTCCGGGAAGGCGCCCGCAACAGGAATAAGTCAGAAGACCTGCCATGTAAAATCCGTTTCACTG
BT1489 btuB1 -387 104.2 TATCTTTGTCGCGCATTGGTTTGCAACTCTCATGCACGAGGGAAGCAATTAAAAGGGAATCAGGTGAAAGTCCTGAACAGTCCCGCTGCTGTAAGTTCATTTTTTGGTTGCGAGCAATCGACTTTATAGCCACTGGAAAGCAAATTCCGGGAAGGCGTTCGCAACAGGAACAAGTCAGAAGACCTACCATGCAAACTCGTTTCACTGC
BT2095 null -394 97.5 AGTATCTTTGCACCTGCAAGGTTCGTATTTGGAGTTGTCTAACCTTCCAAAACGATGAAAAGGGAATCCGGTGTAAATCCGGGACAGTACCTGCTGCTGTAAGTCCTCTCTTTCGGGAGATGAGTTTATCACATTCTTTGCCACTGGTGACATCACTGGGAAGGCGTGATAAATGGGGACGAGTCAGAAGACCTGCCTTGACGCTGCAGATTTAT
BT1957 null -348 110 AATTTTGCAGTCGGGAAATGGTTTCGGGAGGTTTACGCCTTCCGAATGAAAAGGGAACCCGGTGAAAATCCGGGACAGTACCCGCTGCTGTGAGTCCACAAAAACGGACATCGAACTTTTGCCACTGGTGTAATACCGGGAAGGCACGATGACCGGGACGAGTCAGAAGACCTGCCATGACCGGAATGAGATTT
Bacteroides ovatus ATCC 8483
BACOVA_03265 btuB1 -536 85.5 TCTAACTTTGTGCCATTAAGGTTTCCTTAAACAACTTTTGCGTTGTTAAGGAATGAAAAGGGAATGCCGTGTAAACCGGCAACAGAACCTGCTGCTGTAAATCTCCGCTCCTTGTAATCAGAGAGCAAAATTGCAACACGAAAGTCACTGGATAGTTTATCTGGGAAGGCGTTGCAAAATGGGATGAGTCAGAAGACCTGCCTTGATGCTCTGATTTACA
BACOVA_03267 cbtD -425 93.6 CTATCTTTGCCCCTGAATTGGTTTCAGATAGCCATATCAACTATCTGAATTAAAAGGGAATCGGGTGTAAATCCCGGACAGTCCCGCTGCTGTGAAACTCTATTCAACTTCTTGATATTTACTTTTACCACTGACCGGGTATAGATAGTCAAGGTCGGGAAGGAATCAGGAAGGGAGTCAGTCAGAAGACCTGCCATTCATACCTTTATAGCT
BACOVA_01422 nrdD -227 86.3 TCTTTGTATCTGGTTTCGGAGCTAAAAGAGGTTTAGTCAATGAGGGAACGCTGTGTAAATCGGCGACAGTACCCGCTGCTGTAATTCTCTAAGAATCCGCACAATAAGCCACTGCATCGATGTCGGTGTGGGAAGGTGTTGCGAGGGAGGGATAAGTCAGAAGACCTGCCGGAACTTTTTCTTTTAGTTA
BACOVA_00801 nrdD2 -350 89.9 ACTTTGCCGCCAACATCGGTTTCCGGAATGGCATTATCACCAGACGGAATTAAAAGGGAATCCAGTGAAAATCCGGAACTATCCCCGTAGCTGTAAGTTTTATCTCTCTCATAAAAAAGAGAAATGTTATGGCATTCATTTGCCACTGATTCATGAAACGGATCGGGAAGGCGCCACAACAAAAACAAGTCAGAAGACCTGCCGATAAAATTTCCGTTATTCC
BACOVA_01465 pccC -316 90.5 TATCTTTGCCCCCCGAAATGGTTCAGAATCCGTATCCAACGGACGACGATTAATAGGGAATCGGGTGTAAGTCCCGAACAGTCCCGCTGCTGTGAAGCTCTGTTCAATGTCTTATAATTGAACTAATTTAACGCCACTGATGTTAATCGGGAAGGCAAATAAGACAAGAGTCAGTCAGAAGACCTGCCATTTTGTGTAAGACGCTC
BACOVA_04219 btuB1 -382 97 TATCTTTGTCGCGCATTGGTTTGCGACTCCCATGCGGGGGAAGCAATTAAAAGGGAATCAGGTGTAAATCCTGAACAGTCCCGCTGCTGTAAGTTCCATGCATGTTACAAGCAATTCACTCATTGCCACTGGAGACTAATCTGGGAAGGCGTTTGTAACAGGAATAAGTCAGAAGACCTACCATGCAATTATGTTTCACTGC
BACOVA_04709 null -352 102.5 CTTAACTTTGCACCAGTTAAGTTTCCTATCGAAGTGTCGATTGGAATTAAAAGGGAATCCCGGTGAAAATCCGGAGCTGTACTCGCAGCTGTAAGTCCTATTAAAGTTTATCGCACTCTTTGCCACTGGTGAAAGCTGGGAAGGCGCGATAAGCGGGATGAGCCAGAAGACCTGCTTGATAAGATATGATTTAG
Bacteroides fragilis NCTC 9343
BF3484 nrdD -216 98.1 CCTTTGTAGCAGATTTCAGTACTAAAAAGAGGTTTAGTCATAAGGGAACGCTGTGCAAATCGGCGACAGTACCCGCTGCTGTAATTCTCTGAGAATCCGCACACTATGCCACTGCGCCCAGCGTGGGAAGGCGTTGCGAGGGAGAGATAAGTCAGAAGACCTGCTGAAAAAGTAAACATATTTAA
BF2713 nrdA -286 90.8 ATCTTTGCTCCCTGATCGGTTCCGAATAGTCATTCCTCTATCCGGATTAAAAGGGAATCGGGTGTAAATCCCGGACAGTCCCGCTGCTGTGAAGCTCCGTCTGAATTTCCGATAACAACTGTTGCCACTGGGATACCTTTTTGTAAATAGATAAGGAGTCACCGGGAAGGCGTCGGAAACAAGGAGTCAGTCAGAAGACCTGCCGCTTATCAAAGGCTGTTTCC
BF2538 cbtD -561 92.9 CTTATCTTTGTCCCGAATTGGTTTCGAATGAAGACTTTCGTCATTCGGATTAAAAGGGAATCGGGTGTAAATCCCGGACAGTCCCGCTGCTGTGAAGCTTCATCGATATCTTGAAACAATCCTTTCGCCACTGACGTGGGGGGAACACCTCCGTCGGGAAGGCTTCAAGATTAGAAGTCAGTCAGAAGACCTGCCGTTCATCAAAGGCTGTTT
BF2539 btuB4 -302 74.1 ATATTTGCAGCCGCTTAGGTGATGCATACCGGACTTTCTGTTCGTTGCATAAAAGGGAATCGGGTGTAAATCCCGAACAGTGCCCGCTACTGTGATCCCCCTGCTCTTCTACTGTTGCCATCATAATCGGAAGAAGATAAGAAAAGCATTTCTACATATACCACTGTCATAGCCTGTAAAGCATGACGGGAAGGTAGCTTTTCAAAAAGGGATAGTCAGGAAACCTGCCGAAGCAGACATAGATAACAG
BF1583 btuB1 -379 100.6 TTTATCTTTGCAGTGCATTGGTTTGTATTCTCCGTGTTCCGGGGATGCAATTAAAAGGGAATCAGGTGCAAATCCTGAACAGTCCCGCTGCTGTAAGTTTCACATCAGATTGTTGTAAGCAACCACCACTTGCCACTGGGAAACGTTTCCTGGGAAGGCGCTTATCAACAGAAACGAGTCAGAAGACCTGCCTGTGCATCTTTTTCATTG
BF3337 pccC -356 86.5 ATATTTGTCGCCGAATTGGTTCGGAATCCGTGGTCAACGGACGAAGATTAAAAGGGAATCGGGTGTAAATCCCGGACAGTCCCGCTGCTGTGAAACTCTGTATAGCATCTTATCAATCAGCCAATTTCGTACCACTGACAGAAAAAGCAAACTCTGTCGGGAAGGTCCCGGTAAGATGTAGAGTCAGTCAGAAGACCTGCCATTCGTGAATAAGAGCATTC
BF2696 metE -272 97.7 TTATATTTGTCGGCAGATTGGTTCGCCGAAGCTTTCCTGCTTTGGGCGATTAAAAGGGAATCGGGTGTAACTCCCGGACAGTCCCGCTGCTGTGAAGTTTTATTATAAACATTCCGACAGGATACTCTTTGGCCACTGACTCGTGTAGTCGGGAAGGCGTTCGGAATGGAAGCTAAGTCAGAAGACCTGCCACTCTCGCTGATAAGTCT
Bacteroides stercoris ATCC 43183
BACSTE_00632 btuB5 -340 80.1 TCTTTACCCCCGGAATTGGCAATCGGGAAGGCATATCCGCCTGCCGATGCAAGGGAATCCGGTGTAAAACCGGAGCTGTACCTGCAGCTGTAATCCTCAATAAAAGATGTTTGTATCCGCAAAAGCCACTGTCGCGGCAACGCGATGGGAAGGTAATACAAGCAGAGGAGAGCCAGAATACCTACCAACTTCCGTAACTTGAGCAC
BACSTE_00919 btuB1 -258 100.8 CCTATCTTTGCCGGCGTTTTGTTCTGCACTCTTGTTCAGGAGGAGGATGAAAAGGGAATCGGGTGAAAGTCCCGGACAGTCCCGCTGCTGTAAGTTCCGTAAAAGATGTATTAATACTTATGCCACTGTTCTTGAAGAATGGGAAGGTGATACATCAGGAATAAGTCAGAAGACCTGCAAAACGAAGTCAAAAAATT
BACSTE_00799 null -348 110 AATTTTGCAGTCGGGAAATGGTTTCGGGAGGTTTACGCCTTCCGAATGAAAAGGGAACCCGGTGAAAATCCGGGACAGTACCCGCTGCTGTGAGTCCACAAAAACGGACATCGAACTTTTGCCACTGGTGTAATACCGGGAAGGCACGATGACCGGGACGAGTCAGAAGACCTGCCATGACCGGAATGAGATTT
BACSTE_00635 btuB4 -337 74.1 ATATTTGTCACCGCTTAGGTGATACACTCCGTTATTCCAACGAGTTGTATAAAAGGGAATCCGGTGCGAAACCGGAACAGTGCCCGCTACTGTAAAGCCACTTTGCTCCGCCTGCTTGTTGCAGCAACGGAGCATACGGAAAACATTCTTCAAAACAATGCCACTGTCTTACAGACGGCTGTTGGTGAGAGCGAACATCAGTTTGAGCCATCGCAGACCGGAGACGGGAAGGTGTGGTTTTCCGTAGGGCTGAGTCAGGAAACCTGCCTGGGCAATTACACAGTCAAC
BACSTE_01770 BT1483 1831 98.8 ATTATCTTTGCGATGCATTGGTTTGTCGACTTTTTTCAAAGGAGGCGATTAAAAGGGAATCAGGTGCAAGTCCTGAACAGTCCCGCTGCTGTAAGTTTCACATAATGTTGCAGACAATGAATTCTCTCTCCATGCCACTGGAAACGTTTTCCGGGAAGGCAGCCTGCAACAGAAACAAGTCAGAAGACCTGCCATGCATTATCTTATCATT
Bacteroides eggerthii DSM 20697
BACEGG_02061 BT1483 1830 102.3 ATTATCTTTGCAATGCATTGGTTTGCTTCCTTTTTTCAAAGGAGGCAATTAAAAGGGAATCAGGTGTAAGTCCTGGACAGTCCCGCTGCTGTAAGTTTCACACAATGTTGCAGACAATAAAACTCTCTACCCATGCCACTGGAAATATATTCCGGGAAGGCAGTCTGTAACAGAAACAAGTCAGAAGACCTGCCATGCACCATTTTATCATT
BACEGG_00933 null -346 110 TTTTGCAGTCGGGAAATGGTTTCGGGAGGTTTACGCCTTCCGAATGAAAAGGGAACCCGGTGAAAATCCGGGACAGTACCCGCTGCTGTGAGTCCACAAAAACGGACATCGAACTTTTGCCACTGGTGTAATACCGGGAAGGCACGATGACCGGGACGAGTCAGAAGACCTGCCATGACCGGAATGAGATTTAC
BACEGG_02215 btuB1 -255 107.1 TTATCTTTGCGGCGTTTTGTTCTGTCTCCTTGTTCGGGGAACAGATGAAAAGGGAATCGGGTGAAAGTCCCGGACAGTCCCGCTGCTGTGAATTTCGTTGAGGGTGTATCATTCTTATGCCACTGTTCTATTAGGAATGGGAAGGCGATACATCAGGAATAAGTCAGAAGACCTGCAAAACAAAGTCGAAAAATTGT
Bacteroides uniformis ATCC 8492
BACUNI_02911 pccC -341 99.2 TTATCTTTGCCCGCGAATTGGTTCCGGATGCATGTTTCCATCATCTGGATTAAAAGGGAATCGGGTGTAAATCCCGGACAGTCCCGCTGCTGTGAAGCTCCGTTTATATCATGAAAAACACCCTTGCCACTGATATGCATTGAAATATCGGGAAGGCTTCAGGATTAGGAGTCAGTCAGAAGACCTGCCATTCATTAAAGGCTGCCT
BACUNI_02897 null -336 110 AATTTTGCAGTCGGGAAATGGTTTCGGGAGGTTTACGCCTTCCGAATGAAAAGGGAACCCGGTGAAAATCCGGGACAGTACCCGCTGCTGTGAGTCCACAAAAACGGACATCGAACTTTTGCCACTGGTGTAATACCGGGAAGGCACGATGACCGGGACGAGTCAGAAGACCTGCCATGACCGGAATGAGATTT
BACUNI_04579 btuB1 -100 103.5 CCTATCTTTGTCCACGTTTTGTTCCGCGTTCTCTATCCGGAGAAGCGGATGAAAAGGGAATCGGGTGAAAGTCCCGAACAGTCCCGCTGCTGTGAGTTCCATGCTCGGTGTATCATACTTGTGCCACTGTTCTTCGGGAAGAACGGGAAGGCGATGTACCGGGAACGAGTCAGAAGACCTGCAAAACAAAGTCGAAAAATT
BACUNI_02913 btuB3 -329 99.4 ATCTTTGTCCCAGTTTTGGTTTCACCTCTCCCGGTTCTGTTGGAGATGAGTGATGAAAAAGGGAATCAGGTGCAAATCCTGAACAGACCCGCTGCTGTAAGTCCTTCCAAAATCTTTGAATATTCTACAAGCCACTGTCCGCCCGGCGGATGGGAAGGCATTCAAAGAGGGATAAGTCAGAAGACCTGCCAAGACAACATAGTTTTAGTG
BACUNI_01435 BT1483 2122 106.2 TATCTTTGTCATGCATTGGTTCGCTCCCCCTCTTCTGGGAAAGCGATTAAAAGGGAATCAGGTGTAAATCCTGGACAGTCCCGCTGCTGTAAGTTTCGTGCAACGTTGCAGACAATTACTCTATGCCACTGGAATATTCTTCCGGGAAGGCGCCTGCAACAGAAACAAGTCAGAAGACCTGCCATGCATACTTTATCATTGCT
Bacteroides cellulosilyticus DSM 14838
BACCELL_04594 btuB5 -348 73.2 TATCTTTGCAATCGGAATTGGCAATCGGAAAGTATATCAATGCGTCCGACTCAAGGGAATCCGGTGTAAAACCGGAGCTGTACCTGCAGCTGTAATCCTCATTAAGAAAAAGTCTGTAACCACAAAAGCCACTGACGCCGCAATGCGATGGGAAGGCGATACAGACAGGGGAAAGCCAGAATACCTACCAACTTCCGTTACTTGAGC
BACCELL_00563 pccC -494 90.5 ACTATCTTTGCCCCGAATTGGTTTCGGATGAACATTTCTGTCATTTGGATTAAAAGGGAATCGGGTGTAAATCCCGGACAGTCCCGCTGCTGTGAAGCTCCATAACTTTCTTGATAAATACTTTAGCCACTGGCTGTGAATTGGAGGCCGGGAAGGAATCAGAAAGGGAGTCAGTCAGAAGACCTGCCATTCGTTAAAGTCTGTTG
BACCELL_04148 nrdA -279 92.4 TTATCTTTGTTCCCGAATTGGTTCCGAATGGCTCTTCTGCCATTCGGATTAAAAGGGAATCGGGTGAAAATCCCGGACAGTCCCGCTGCTGTGAAGCTCTATACAACTTTTCAATAACACCATAGCCACTGAATGTCTTGCAGTAGAAAAGAAGACATCGGGAAGGCATTGAAAACAAAGAGTCAGTCAGAAGACCTACCATTCATCAAAGGCTGTTT
BACCELL_00566 nrdD2 -352 92 ACTTTGTCAGCGATAACGGTTTCCAAATCACCGCAAGCGTGAAATGGAATTAAAAGGGAATCCTGTGAAAATCAGGGACTATCCCCGTAGCTGTAAGTTTCATCTCCCTACCATGTGGAGAAAAGATTGTGGCACTCTTTAGCCACTGGTCCTGCAAAAACCGGGAAGGCGCCACAACGGAAACAAGTCAGAAGACCTGCCGATATCTGTAATCATTCAGG
BACCELL_01030 btuB1 -203 97.1 TATCTTTGCCCTTCGGTTTTGTTGAAGTATGCCTTTCGGTATGCTTCATGAAAAGGGAATTGGGTGTAACTCCCAAACAGTCCCGCTGCTGTAAACTCATTGTCAAGGATTTACCAATCACCTATGCCACTGCCGGTATTCGCACGGTGGGAAGGCGGTAAATCCGGAGTAAGTCAGAAGACCTGCAAAACCTATCAAATTTTAT
BACCELL_01617 btuB1 -356 98.1 TATCTTTGCCATTGATTATGGTGTCACCCGTCGCTTTCGTGGCGGGTGGTGAAAAGGGAATCAGGTGTAAATCCTGAACAGACCCGCTGCTGTAAGCTTCAAACAAAGTCTGAAGACGATACTCACGCCACTGTTTTCTGCATGAACGGGAAGGGAGTCATCAGATGAAGCAAGTCAGAAGACCTGCCATGATCTGGAATCAGGAG
BACCELL_04591 btuB3 -336 92.1 ATATCTTTGCAGCGTTTTTGGTTTCGCATCTCCTTGGCTCTATGGGAATGCGATGAAAAGGGAATCAGGTGCAAGTCCTGAACAGACCCGCTGCTGTAAAATCCTTTCAAAATCTTGAATATACTCCAATAGCCACTGTCTGCTGGTCGGATGGGAAGGCATTCAAAGATGGATAAGTCAGAATACCTGCCAAGAACAACATAGTTTTA
BACCELL_05151 BT1483 1589 108 TATCTTTGCGATGCATTGGTTTACTGTCTTTGTTCGGAGACGGTAATTAAAAGGGAATCAGGTGCAAATCCTGAACAGTCCCGCTGCTGTAAGTTTCATGATAGGTTGCAGGCAAACTACCAATAGCCACTGGAAGTCCGCTTCCGGGAAGGCGCCTGGCAACAGAAACAAGTCAGAAGACCTGCCATGCACTGTTTTTATCACTG
Bacteroides vulgatus ATCC 8482
BVU_3105 nrdD2 -348 95.3 ACTTTGTCAGTAATATCGGTTTCCGGATTAGCCGTTGGCGCGAAACGGAATTAAAAGGGAATCCTGTGCAAATCAGGAACTATCCCCGTAGCTGTAAGTTTTATCCTCCCATAGTGTGGGGAAGTGTTGTGACATTCTTAGCCACTGGTTATTGTGAAAACCGGGAAGGCGCTACAACGGAAACAAGTCAGAAGACCTGCCGTTATTGTTTATATCATTCA
BVU_3098 nrdA -276 88.3 TTATCTTTGTTCCCGAATCGGTTCCGAATAGATGTCCTCTATCCGGATTAAAAGGGAATCGGGTGTAAATCCCGGACAGTCCCGCTGCTGTGAAACTCCGATAAAATTTCCGATACGTACCTATTGCCACTGCCTGACTCCACATAACGAGAACGCGGGAAGGCATCGGAAATGAGGAGCCAGTCAGAAGACCTGCCATTCATCAAAGGCCGTTT
BVU_3108 btuB5 -332 80.1 CTATCTTTGCAACGGAATTAGTAATCGGGCTATCACATAGCCCGATGCAAGGGAACCCGGTGTAAATCCGGGGCTGTACCTGCAGCTGTAAATCCTCATGATGTTGATTGGATAGTCTAAAACCACTGTTTCATTTGAAGAAATGGGAAGGTTTCCAATCAGAGGAAAGCCAGAATACCTGCTAAGTCTGTTGAACAATAA
BVU_3110 btuB4 -260 87.4 CTACCTTTGTGCCCGATTTGGTGATATAGGCAGCCTTTCTCTGCCTGTATAAAAGGGAATTCGGTTATAGAATCCGAAGCAGTGCCCGCTACTGTGAAACCCGTCTGATGAAAAGCAATTCTCACCAAGCCACTGTTTCTTTTGCCAGAAATGGGAAGGCGCTTTTCAGGGTGAAGCCAGGAAACCTGCCAAGTCCGAACATAGATAA
BVU_3104 pccC -488 101.3 ATTATCTTTGCCCCGAATTGGTTTCGGATAGTCTATCTGCTATTCGGATTAAAAGGGAATCGGGTGCAAATCCCGGACAGTCCCGCTGCTGTGAAACTCTGCTGGAATCTTGAAAAATACCTTTGCCACTGATGTGACAATCCTCACATCGGGAAGGCTTCAAGATAAGGAGTCAGTCAGAAGACCTGCCATTCATTAAAGGCTGTTT
BVU_3092 btuB4 -258 85.8 CTACCTTTGCATCAGATTTGGTGATGTAAGTACTTTCCGTATTTGCATAAAAGGGAATTCGGTCATAGAATCCGAAGCAGTGCCCGCTACTGTGAAACCCGTCAATGAAAAGCAACTCTCGCCATGCCACTGTTTCCTTTGTAAGAAATGGGAAGGCGCTTTTCAGGGTGAAGCCAGGAAACCTGCCAGGTCTGAACATAGATAA
BVU_2057 btuB1 -293 86.3 AACTATCTTTGCCATGTTTTGTTCCGCGTACCTCCGACTGATGCGAGGAAGCGGATGAAAAGGGAATCAGGTGCAAGTCCTGAACAGTCCCGCTGCTGTAAGCTCCATCTACCTCTATAAGGGGATAGGTTTACTTATCCACTCACGCCACTGCCTGTATATATAATAAGGTGGGAAGGCAAGTAAACAGGAGTAAGTCAGAAGACCTGCAAAACGTAAAGTCATCGAC
BVU_1654 nrdD -214 90.7 CTTTGCAGCTGTCCGACAAGGTGAAGTTAACCACTTCCAAGAGGGAATGCCGTGAAAATCAGCAACAGTACCCGCTGCTGTAATTCTCGTAGAGCTGAAACAATATGCCACTACAAAACCATTTGCGGGAAGGCGTTTTAAGGGAGAGATAAGTCAGAAAACCTGCCTGGAAGGACAGCCAAGTT
BVU_4096 BT1483 1874 97.7 TATCTTTGCAGTGCATCGGTTCATTTATCTCCCCTCCGAGGTGAATGATTAAAAGGGAATCAAGGTGAGAATCCTGAACAGTCCCGCTGCTGTATGTTTCACTAAACGCATAAGCAAAATGCCAATAACCACTGGGATAATTTCCGGGAAGGTGCTTATAGCGGAAACGAGTCAGAAGACCTGCCTGTGCATTTATCAAATCTGA
Bacteroides dorei DSM 17855
BACDOR_02869 btuB5 -330 77 ATCTTTGCAACAGAATTAGTAATCGGGCTATCACATAGCCCGATGCAAGGGAATCCGGTGTAAATCCGGGGCTGTACCTGCAGCTGTAAATCCTCATTATGTTGATTGGATAGTCCAAAACCACTGTTTCATTTGAAGAAATGGGAAGGTTTCCAATCAGAGGAAAGCCAGAATACCTGCTAAGTCTGTTGAACAATAAAC
BACDOR_02878 nrdA -274 88.7 ATCTTTGTTCCCGAATCGGTTCCGAATAGATGCCCTCTATCCGGATTAAAAGGGAATCGGGTGTAAATCCCGGACAGTCCCGCTGCTGTGAAACTCCGATAAAATTTCCGATATGTACCTATTGCCACTGCCTGACTCCACATAACGAGAACGCGGGAAGGCATCGGAAATGAGGAGCCAGTCAGAAGACCTGCCATTCATCAAAGGCCGTTTCT
BACDOR_02872 nrdD2 -350 94.3 TAACTTTGTCAGTAATATCGGTTTCCGGATTAGCCGTTGGCGCGAAACGGAATTAAAAGGGAATCCTGTGCAAATCAGGAACTATCCCCGTAGCTGTAAGTTTTATCCTCCCATAGTGTGGGGAAGTGTTGTGACATTCTTAGCCACTGGTTATTGTGAAAACCGGGAAGGCGTTACAACGGAAACAAGTCAGAAGACCTGCCGTTATTGTTTATATCATT
BACDOR_02883 btuB4 -257 84.2 ACCTTTGCATCAGATTTGGTGATGTAAGTACTTTCCGTATTTGCATAAAAGGGAATTCGGTTATAGAATCCGAAGCAGTGCCCGCTACTGTGAAGCCCGTCCAATGAAAAGCAACTCTCGCCATGCCACTGTTTCCTTTGTAAGAAATGGGAAGGCGCTTTTCAGGGTGAAGCCAGGAAACCTGCCAAGTCTGAACATAGATAATT
BACDOR_02868 btuB4 -259 88.8 ACCTTTGCGCCCGGTTTGGTGATACAGATATTTTTTCTCTATCTGTATAAAAGGGAATTCGGTTGTGGAATCCGAAGCAGTGCCCGCTACTGTGAAACCCATTTGATGAAAAGCAACTCTCGCTATGCCACTGTTTCGAAAATGAAGAAATGGGAAGGCGCTTTTCAGGGTGAAGCCAGGAAACCTGCCAAATCAAAACATAGATAATC
BACDOR_03419 btuB1 -294 84.9 AACTATCTTTGCCACGTTTTGTTCCGCGTACCTCCGACTGATGCGAGGAAGCGGATGAAAAGGGAATCAGGTGCAAGTCCTGAACAGTCCCGCTGCTGTAAGCTCCATCTACCCCTATAAGGGGATAGGTTTATTTATCCACTCACGCCACTGCCTGTATATATAATTAAGGTGGGAAGGCAAGTAAACAGGAGTAAGTCAGAAGACCTGCAAAACGTAAAGTCATCGAC
BACDOR_00281 nrdD -214 91 CTTTGTAGCCGTCCGACAAGGTGAAGTTAACCCCTTCTAAGAGGGAATGCCGTGAAAATCAGCAACAGTACCCGCTGCTGTAATTCTCGTTGAACTGAAACAATATGCCACTACAAAACTATTTGCGGGAAGGCGTTTTAAGGGAGAGATAAGTCAGAAAACCTGCCTGGAAGGACAGCCAAGTT
BACDOR_00736 BT1483 1780 97.4 TGTATCTTTGCGGTGCATCGGTTCATTTATCTCCCCTCCGAGGTGAATGATTAAAAGGGAATCAAGGTGAGAATCCTGAACAGTCCCGCTGCTGTATGTTTCACTAAACGCATAAGCAAAATGCCAATAACCACTGGGATAATTTCCGGGAAGGTGCTTATAGCGGAAACGAGTCAGAAGACCTGCCTGTGCATTTATCAAATCT
Bacteroides coprophilus DSM 18228
BACCOPRO_02029 null -344 106.3 TTTTTGTAATTGGAAATGGTTCCGGGCGGTTCGCCGCCACGGATGAAAAGGGAATCCGGTGAGAATCCGGGACAGTACCCGTTGCTGTAAGTCCCCTCAAGGTTGCCGCAACCTGCCACTGGTGTAATGCTGGGAAGGCGCGACGACTGGGACGAGTCAGAAGACCTGCCATGACCGGAAAAGGATTTAC
BACCOPRO_03547 btuB1 -272 92.8 TCCTACCTTTGCGAAGTCTTGTTCTGTAAACCTCCTTTCCTGAGGTTTCAGATGAAAAGGGAATCGGGTGAAAGTCCCGGACAGTCCCGCTGCTGTAAGCTCCATAAAAAGGGTTGCCCATCTATCCTTTAGCCACTGCCCCCGAAGCAACCGGAGGGTGGGAAGGCCGGGCCAACCGGAGTAAGTCAGAAGACCTGCAAGACAAAAGCCATGTTTG
BACCOPRO_02553 nrdD -227 88.7 TTTGTATCGCTTTTCAAGGTAACGGAAGCGTTTCAAAAGGGAATGCCGTGAAAATCGGCAACAGTACCCGCTGCTGTGATTCTTTAAAAGCCCAGACAAGGCCATGCCAGCCACTGTAAATAACCATTTATGGGAAGGCGTTTGGGGAAGAGATCAGTCAGAAGACCTGCCGGAAAAAGCAAATGACATGT
Bacteroides plebeius DSM 17135
BACPLE_00041 btuB1 -259 105.6 TTACCTTTGCCCTCAGAATGGTTTCGGAAGCCTGTTCAGACTTTCGGATTAAAAGGGAATCAGGTGCAAATCCTGAACAGTCCCGCTGCTGTAAGCTCCATTCAACCTGCTGGAAAAGACTCATGCCACTGATGACTGAACACTATCGGGAAGGCTCCAGCTGGGGAGTAAGTCAGAAGACCTGCCATCATACATGTAAACCGT
BACPLE_02584 null -345 102.6 TTTTGCAATCAGGAAATGGTTTCGGGAGGTTTACCACCTTCCGGATGAAAAGGGAATCCGGTGAAAATCCGGGACAGTACCCGCTGCTGTGAATCCACAAAAACGGACATCGAATTTTTGCCACTGGTGTAATACCGGGAAGGCACGATGACCGGGACGAGTCAGAAGACCTGCCATGACCGGAATGAGATTTAC
BACPLE_03828 nrdD -222 81.2 TTTGTCCTGCTTTTCAAAAGGTAACCTAACCGTTTCAAAAGGGAATGCCGTGGAAATCGGCAACAGTACCTGCTGCTGTGATTCTTGCGTAAACCTGGACATGCATTGCAAGCCACTGTGAATCGAATTCATGGGAAGGCGTCTGTGGGGAAAGATCAGTCAGAAGACCTGCCCGGAAAAGCTCAACTATA
BACPLE_03025 btuB1 -276 94.2 ATGTATATTTGCAATGTTTTGTTCCGTATTGATTTCCGGTTAAGCGAAATCGCGGATGAAAAGGGAATCGGGTGAAAGTCCCGGACAGTCCCGCTGCTGTAAGCTCCAGTCATTTACGTTTGTCTACCCTCTGCAAGGCCACTGTCTTTTAAATAAAGATGGGAAGGCAAGACAAACGGGAGTAAGTCAGAAGACCTGCAAAACAAAGTCATGCTTGC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD