Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Cobalamin in Corynebacteriaceae

Properties
Regulator family: RF00174
Regulation mode:
Biological process: Cobalamin biosynthesis
Effector: Adenosylcobalamin
Regulog: Cobalamin - Corynebacteriaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Corynebacterium glutamicum ATCC 13032
cg0625 null -217 25.7 CAGGGGAATTTCGGTGAGAACCCGAAGCTGACCCGCAACCCGTATTATGCAATCGCTTTCACCAGGTATTGCATTAAGCCGGATCACCC
Corynebacterium diphtheriae NCTC 13129
DIP1084 btuC -252 84.3 GTGTTACACATTGATTAGGTGCAGCATAGAACTGCTGCATGGGAATCTGGTGAAAATCCAGAGCTGACGCGCAGCGGTGAAGGTGCAAGTGAGTGCTTCAATGTAGCCACTGAGAGTATAAAAACTCTTGGGAAGGTGAGGCAATTACTCTCGCGTAGAGCACCCCAGTCCGAAGACCGGCCTAATCAGAAACATGTGCTGC
Corynebacterium amycolatum SK46
CORAM0001_2224 cbiM -325 43.9 ATTCTGAGACGTGATTTACAGTGCACGGGAATGCCTTGTAAATAGGCAGCGGCCCTCGCCACTGTGATTGGGCGCGATTGCGGCCCTTATCTGCACAGCGGTTATATGCGATAACCGGAAAACGCAGACAATGGACTCAGCGATTGCGGTGCTTCGTCGAAGCCACTCAGGGGGACTCAAACCTCTGGGGAAGGAGGCGAGGCATTAGTAGAAGTGTGAAGCCTTCCTCAGCCCATCAGCCAGGAGACCGACTGTAAATCATCCAATTCGC
CORAM0001_1322 metE -218 35 GTGTGTTTTGAGCTTAGCGCGCATGAAGCCCTCGAGTTATGCAGGGGAATCCCGGTGCAAGTCCGGAACTGTCCCGCAACGGTAAGCATCACTGCCAGAACTTTGGTTTATTCGACGCTTTGATAACCAATCTTGCAGTGATGACAAGTCCGAATGCCTGCCGGTTGTGCAATTTCATAT
Corynebacterium kroppenstedtii DSM 44385
ckrop_1726 metE -344 55.4 CGATAAGTAATGCGATAAGTTCTTCTGCCCCGCGAATGGTTTTGCCCCTCTCGTGAAGCAGAAATACCAGGGAATCCGGTGCGAATCCGGAACTGTCCCGCAGCGGTATGTGAGAAAACCAAACGACACAATGACGCACTGGTGACCCTCCCCAACCTGGAGAACGCTGGGAAGCAGTGTCAATTAGGTTCCGCCCCGGATGGCCACAACCTCACGGCCATCAGGAACAGCATCAGGAGCAGCGCACTACATCGCGCACCAGCGGAGTGCTCACGAGTCCGAATACCTGCTTATCGTCGCGGAGCCCGCCG
ckrop_0414 btuF -136 36.2 GGAATGCAGTGCGAATCTGCAACTGACGCGCAACGGTGACACGCTATTTTGCGTTAAGTCCGGATACCGC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD