Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Cobalamin in Cyanobacteria

Properties
Regulator family: RF00174
Regulation mode:
Biological process: Cobalamin biosynthesis
Effector: Adenosylcobalamin
Regulog: Cobalamin - Cyanobacteria
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Synechococcus sp. PCC 7002
SYNPCC7002_A0637 btuB -512 62.1 ATATAATTAGACTCTGTTCGGTTTTATCGGGGATCAGCCGATAAAAGCAATGGGGAAAGAACGGTGCAAATCCGTCGCTGTCCCGCAGCTGTAAGGAAATTTTCAGCAATTTCTAAGTCAGAATGCCCGCCGAGCCAAGCATAAACGTT
Cyanothece sp. ATCC 51142
cce_0951 hupE -217 58.2 ATAATACTCAAGCTATCGGTTTTAGTGGGGAACAGTCACTAAAGGTAACAGGGAAAGCTTGGTGTAAGTCCAACACTGTCCCGCAACTGTGATGAAGCTTAAATGATTAGTTTCTAAGTCAGAATGCCTGCCGATAACGAGACTATTCTTAT
cce_4820 null -298 55.3 ACAATGCAAAAAATATCGGTTCTAGTGGAGATCAGCCATTAGAGGTAACGGGGAAAGTTCGGTGTAAATCCGTCGCTGTCCCGCAACTGTGATGAGACGTTTCAACTTCTCTTAGTCAGAATGCCCGCCGGTTAATTAATCCACGTTCA
Cyanothece sp. PCC 8801
PCC8801_2095 hupE -189 60 ATTATACCGAGGCTATTGGTTCTAGTGGGGAACAGCCACTAGAGGTAAGGGGGAAAGTTTGGTGTCAGTCCAACGCTGTCCCGCAACTGTGATGAAATTTTGAGCAAAAATCGAATATTTCTTAGTCAGAATACCCGCCAATTATTTAGCCAAATTAGT
Cyanothece sp. PCC 7425
Cyan7425_5052 hupE -183 40.9 TTGAACAATGTGTCATTGGCTCCGGTGGGGAACAGCCACTGGAGGTAGTTACTGCACTACTGGGGAAAGCTCGGTGTAAGTCCGACACTGTCCCGCAACTGTGAAGGAGCAATTCTCCCAGTCAGAATGCCCGCCAATGGTTCCCTTCGGTTTAG
Cyan7425_1197 cbiX -201 25.6 TAAGATAACCACGTACTCGTGAACAGTCGTTTTCCGGGAAAATCCAGTGCTCCTGCCAGGGATAACGGATCAGCCATCAAACTATTCAAAGCAGGAAAATCTGGTGCTGTGCCGCAACTGTGATGGAAGCTTCCTCAGCCAGAACACCGGAGAGCCACTTTTTCACTCTTAC
Nostoc sp. PCC 7120
alr4027 cfrX -546 61.7 TTTTTCAATATCAACTCGGTTCTGGTGGGGATCAGCCATCAGAGGTAAGGGGGAAAGTCCGGTGTAAATCCGGCGCTGTCCCGCAACTGTAATGGGGCTTATGCCTCAAAGTCAGAATGCCCGCCGAAAGTACAACAAATTCTTA
all1781 cfrX -195 34.4 TACCATTAAATAAATATTCGGTTCTGGTGGGGAGCAGTCACCAGAGGTAACGGGGAAAGTATACCTGCAATCTTTCGTAGGTGAACGGTGTAAGTCCGGCGCTGTCCCGCAACTGTGAAGGAAAGAAAACTCTTGTAACTTTCCCAGTCAGAACGCCCGCCGAAATTGACGATTCTCAA
all0456 cobG-cbiC -109 33 TGGTAGATTACTAGAACTTGGTGTTGGGAAACTCCGGTGCGATTCCGGGGCTGTGCCGCAGCTGTGATGAAAAGTCCCAAGAATTTCTCTTGTAACTTTCCGAGTCAGAATGCCAATTCCAAGAGTTAGCTG
Synechococcus elongatus PCC 7942
Synpcc7942_1373 hupE -166 56.8 ATATAATCACTAGGCTAACGGTTCTAGCGGGGATCAGCTGCTAGAAGCAATGGGGAAAGTGCAGTGTAAGTCTGCCGCTGTCCCGCAACTGTAATGAGACTATTGGTCTCTGAGTCAGGACGCCCACCGTTATCCCGTCAAAACAC
Synpcc7942_1851 cobG -235 31.3 GCAGTGACCAGCCCCATGCTATGCTGCTGAGACTTAAGGATTGGGAAAGTCCGGTGTGATTCCGGTACTGTGCCGCAACTGTAATCAACTTTTAGGTATCACAATCGGCTATCAATGTGATTGCTCTTGATAGAGATATCTAGAAGCCCATGGAGTCAGAATGCCAGCCTTGAGGAGTGTCGAAAAGAC
Prochlorococcus marinus str. MIT 9313
PMT0232 hupE -207 53.2 ATGATTGAATCCATCAATCGGTTTCAGCAGGGATCAGCTGCTGAAGGAAACGGGGAAAGTTCGGCGAAAATCCGGCACTGTCCCGCAGCTGTAAAGCGCAACCACCCTTCTTAGAGCACTTGCGCGAGTCAGAATACCCGCCGAATTTCCATCGACGAGG
Synechococcus sp. JA-3-3Ab
CYA_1108 btuB -182 46.7 GAGGAAAGCCGTGCCGTCAGGTTGTCCTGGGGATCAGCCAGGGCAAGCAATGGGGAAAGTCCGGTGCAAATCCGGCGCTGTGCCGCAACTGTGATGGGCTGAGGCCCTCAGTCAGGATGCCCGCCTGCGGCTTTGGCTCAAAG
CYA_0167 metE -612 45.8 TAGGATAAAGTCTACTGTCGGTTCTGACGGGGATCAGCCGTCAGAGGCAACGGGGAAAGTGCAGTGAGAATCTGCCGCTGTCCCGCAGCTGTGAGCCGGTTTTGGACTTGGGATCCCTAGTTCGTTGTTGCAAGAGGCCTTGAAACGCAAGCCAGCCCCTCCAAAACTGAGCAAGTCAGAATGCCCGCCGGCGGTTTTTCCACAGTT
CYA_2373 cbiX -172 38.1 GGGCTTGGTGAACGGCAGGCGGCAAGCTAACCTAAGAAGCTCGGGCAGACTGGGGAAAGCGCGGTGCAAATCCGCCACTGTGACGCAACTGTGATGGGATCCCTCCCTCAGCCAGAACACCCACCTGCCCTTGTCCTGTACCCCT
Synechococcus sp. WH 8102
SYNW2127 hupE -75 44.2 CCCTAGGGTTTGGGTCTGGTTTCAGCGGGGATCAGCCGCTGATGGAAACGGGGAAAGAACGGTGCAAATCCGTCGCTGTCCCGCAGCTGTAAAGCGTCCGGCCCCGCCGGCGTCAGTCAGAACGCCCGCCAGGAGCACTACCGACGAGGA
Gloeobacter violaceus PCC 7421
gll4193 cbiX -122 30.3 CCCGCGCCTTGCAGCGCAGGGTGATAACCTGTTGAGGTCCAAAAGCGGGAAAGTCCGGTGCGATCCCGGTACTGTGCCGCAGCTGTAATGGGCTTCCCAAGTCAGAATGCCGCCTTTGGACGTTGCCTCCGG
glr1973 btuB 15 41.9 ACAATCGAATGGCTTTGGGAGCCCGGGGGATCAGCCCGGGCTGAAAGGGGAAAGTCCGGTGCGAGTCCGGCGCTGTGCCGCAGCTGTGATGGCTTGAGAGCAAGCCTCAGTCAGAATGCCCGTCCCACAAAAGCCGCATTCCAC
Thermosynechococcus elongatus BP-1
tlr1090 metE -418 52.3 GGTTGGCTTAGTTGCTCGGTTCTGGTGGGGATCAGCCATCAGACGTAAGGGGGAAAGTGCAGTGTGAATCTGCCGCTGTCCCGCAGCTGTGAGGAGAGATCTCACTCTCTAAGTCAGAATGCCCGCCGAGTGGTCAACCCGATACGT
null cbiX -156 29.7 ATTGGCGACGTTCACTGTGAGAAGCAGCCTGTAGGGAAAATCCAGTGCAAGTCTGGTGCTGTGCCGCAGCTGTGATGGGAATCTTCCCTCAGCCAGAATGCCTACTTGCTGTGGTTCACTCTAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD