Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Cobalamin in Enterobacteriales

Properties
Regulator family: RF00174
Regulation mode:
Biological process: Cobalamin biosynthesis
Effector: Adenosylcobalamin
Regulog: Cobalamin - Enterobacteriales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Escherichia coli str. K-12 substr. MG1655
b3966 btuB -254 86 TGTAGCATCCACTTGCCGGTCCTGTGAGTTAATAGGGAATCCAGTGCGAATCTGGAGCTGACGCGCAGCGGTAAGGAAAGGTGCGATGATTGCGTTATGCGGACACTGCCATTCGGTGGGAAGTCATCATCTCTTAGTATCTTAGATACCCCTCCAAGCCCGAAGACCTGCCGGCCAACGTCGCATCTGGTT
Salmonella typhimurium LT2
STM4130 btuB -258 81 GGTAGCATCCGTGGGCCGGTCCTGTGAGTTAATAGGGAATCCAGTGAAAATCTGGAGCTGACGCGCAGCGGTAAGGAAAGGTGAGATGAGAGCGTAAGCAGACACTGCCTCCGGCGGGAAGTCATCATTTCTGCTATCCAGCCAACGGATAACCCTCCAAGCCCGAAGACCTGCCGGCTAACGTCGCATCTGGTT
STM2035 cbiA -273 101 GCCATAACGTAAACCAACAGGTTTGCCACATTTGTGGTAGGGAAGGGGGTGAAAATCCCCCGCAGCCCCCGCTGCTGTGATGCTGACGACCCCGTAAAGACCACTGATCGCAAGATTGGGAAGGACGGGCGAGGAGGACGCTAAGCCAGAAGACCTGCCTGTCGGTGATAACCAACA
Citrobacter koseri ATCC BAA-895
CKO_03025 btuB -256 87.6 AATGTAGCATCCGTGAGCCGGTCCTGTGAGTTAATAGGGAATCCAGTGCGAATCTGGAGCTGACGCGCAGCGGTAAGGAAAGGTGAGATGAGAGCATAAGCAGACACTGCCACCCGGCGGGAAGTCATCGTCTCTTGTATCCTGAGGATAACTTTCCAAGCCCGAAGACCTGCCGGCTAACGTCGCATCTGG
CKO_00802 cbiA -272 98.2 CATAACATCAGCCGACAGGTTTGGCACATTTGTGTCAGGGAAGGGGGTGAGAATCCCCCGCAGCCCCCGCTGCTGTGATGCTGACGACCCCGTAAGACCACTGATCGCAAGATTGGGAAGGACGGGCGAGGAGGACGCTAAGCCAGAAGACCTGCCTGTCGGTATTTACCAACAAC
CKO_01267 btuF -408 83.7 CGATACAGTCGCCAGTGACAGTATTCATAACACAGCCGTTGTTTTGAAAGGAATATGGTGCGGATTATTTTAATCTCATTCCATAGCTGCCCCCGCAACTGTAGGCGGATACCGAATATCTGCGTGTGGTTATTGTAACCACCGGTCACTGTAAAGATTTGCTTTATGGGAAGGCCGATATTCTGATTACCGTGAGCCAGGAGACCTGCTGTCAGGGTTGTACACATT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
KPN_04255 btuB -251 84.2 TGTAGCATTCGCCTACCGGTCCTGTGAGTTAAAAGGGAACCCAGTGGAAATCTGGGGCTGACGCGCAGCGGTAAGGAAGGTGAGAAATGAGCGCACTCGGTGCAGACACTGCGGCTAGCCGTGGGAAGTCATTATTTCTTGAAACAGCCTCCAAGCCCGAAGACCTGCCGGAATACGTCGCACTGGGTT
KPN_03200 cbiA -194 91.1 TCGGCGAAACAAACCGACAGGTTCGACACCAGTTTGGTGTCAGGGAAGGGGGTGTAAATCCCCCGCAGCCCCCGCTGCTGTGATGCTGACGACCCCGCAAAAACCACTGATCGAAAGATTGGGAAGGGCGGGCGAGAACGAGGCTAAGCCAGAAGACCTGCCTGCCGGTAACTGACCAAC
Enterobacter sp. 638
Ent638_4020 btuB -243 88 ATTGTAGCATTCTGTTTCCGGTCTCATGTAAGTGAAAAGGGAATCCAGTGCAAATCTGGAGCTGACGCGCAGCGGTAAAGACTGGCGGGATGAGAGTTGTAGACACTGTGAAAATGGGAAGTCTTCATCCGTAAAACGCCACTAAGCCCGAAGACCTGCCGGAATTACGTCGCATCTG
Yersinia pestis KIM
y0325 btuB -330 83.7 TCGTAGCATTGTGGTCCGGCCTCATGCTGTTATTTAAACACCTAAGAGTTAAAAGGGAATCCGGTGTAAATCCGGAGCTGACGCGCAGCGGTAAGGGGAAGTCACGGCGATAGGTTTCTAACAGACACTGTCCGCAAGGATGGGAAGTCATCGCCTGCTCTATTTCGCGCCATTTATTTATCACAGTATTTTTACTGTCATAACCATGGCCTGATACCAGAGATCCTAAGCCCGAAGACCTGCCGGTATTACGTCGCAATATTC
Serratia proteamaculans 568
Spro_4770 btuB -282 92.9 GATCGTAGCATTGTCGTCCGGCCTCAAGCAGCGAGTGAAAAGGGAATCCGGTTCGAATCCGGAGCTGACGCGCAGCGGTAAGGGGAAGTCACGGCGATAGCGTTTTACGCAGACACTGTCCATTGCAGGATGGGAAGTCATCGCCCGGTGCTGGTCGCTCACAGGCTACCTGCAACTCCCAAGCCCGAAGACCTGCCGGTGTTACGTCGCAATGT
Erwinia carotovora subsp. atroseptica SCRI1043
ECA4238 btuB -368 72.2 GATTGTAGGATGAGCGTCCGGCCTTGTATCACAAGTCAAAAGGGAATCCAGTGTAAATCTGGAGCTGACGCGCAGCGGTAAGGAATGCCCGAGCGATAGCATTATTGCAGACACTGTTATGTACTCTAAATATTTCGAGTTGTAGGACAAAACGTTAACGTTTTGAACAGCGCACATGCAACTTGAAGTATGCTGGGTATCGATGGGAAGTCATCGCTTTCGTTGTATCCCCTACTGTTGTTGACGGTTTGTGGTAACAACGGCATCCAAGCCCGAAGACCTGCCGGAATACGTCGCAATTGG
Edwardsiella tarda EIB202
ETAE_2004 cbiA -273 93.7 ACCATGTAATAAGCCGACAGGTTTGCCATATTAATGGTAGGGAAGGGGGTGTAACTCCCCCGCAGCCCCCGCTGCTGTGATGCTGACGACCCCGTGTACACCACTGATCGCAAGATTGGGAAGGACGGGCGAGGAGGACGCTAAGCCAGAAGACCTGCCCGTCGGTAACTACCAACA
ETAE_1848 cbiP -369 93.5 GCACCCGCAGGTGCACGACGGTTTACCGACGCGATGCGTTCGGGAAGGAGGTGTGACTCCTCCGCAGCCCCCGCTGCTGTGATGCCGACGACCCCGCAGAATGCCACTGATCGCCAAGATTGGGAAGGCGCGGGCGAGAGTGAGGCTAAGCCAGAATACCGGCCGTCATGCCATAACGTAGC
Proteus mirabilis HI4320
PMI3246 btuB -271 96.9 TCGTAGCATAGCGATTCGGTCTCCGATATGGAGTGAAAAGGGAATCTGGTGCAAAGCCAGAACTGACGCGCAGCGGTAATAGGATCAAGGATAATAAAAGACACTGCAATGCACCAAAATCAGTGCTGTGGGAAGTCATTATCTTAAATGCTCAGAGTATTTAACCTAGAGTCCGAAGACCTGCCGAACATTTGTCGCATGTAAA
Photorhabdus luminescens subsp. laumondii TTO1
plu2999 cbiA -289 92.9 CGGGTATAAACCGCCGTTAGGTTAATACCACACCTTAATGGTGTGGTTGGGAAGGAGGTGAAAGTCCTCCGCAGCCCCCGCTGCTGTGATGCTGACAACTCCGCTGATGCCACTGGTCGGAAAGACTGGGAAGGTTGCGGGGAAGGGTGACGCTAAGCCAGAAGACCGACCTGACAGGCACGAGACATT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD