Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Cobalamin in Ralstonia

Properties
Regulator family: RF00174
Regulation mode:
Biological process: Cobalamin biosynthesis
Effector: Adenosylcobalamin
Regulog: Cobalamin - Ralstonia
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Ralstonia solanacearum GMI1000
RS02718 btuB -396 49 GTTACACTCGCCGCGTCCTGGTGCCCGCAGAGCCGATCTGCAGTTAAACGGGAAGCAGGGAGCGGCCGCCCCAAACGGTGCGCCAACCTGCGCTGCCCCCGCAACGGTAAGCGAACGCCGTCGAAGGCCGCGCTACCTCTGGCCAGAAGAGGGCGCGGCGTCGCGCAGGTCCGTCCACATGCCACTGTTCCGCGGAACGGGAAGGCGGCCGGACCCGGTTCGCCAGCCCGGATACCGGCCAGGACAGTGGGTTTCAGA
RSp0628 hoxN -278 121.5 CATCCCGCCTCACGATGATGGTGCCCTTCCAGGGTGAAACGGGAACGCGGTGCGATGCCGCGGCTGCCCCCGCAACTGTAAGCGACGAGTCTGCGCCAACCAGCCACCGCACGATGCCGGGAAGGCGGCGCCAGGCGATGACGCGCGAGCCAGGAGACCGGCCATCTCCTTCTGTCGACGT
Ralstonia pickettii 12J
Rpic_2667 btuB -389 64.8 TTAAACTTCGCCCCGTCCTGGTGCCCGCAGCACCATCTGCAGTTAAACGGGAAGCAGGGAGCGCGCGCCCCAAGCGATGCGCCAACCTGCGCTGCCCCCGCAACGGTAAGCGAACGTCGCGTGTACCCGCCATCTCGCGAAGAAGATGGGTGCCGCGCGGTCTGTCCATACGCCACTGTTCCTTTCGGAATGGGAAGGCGGACAGGCCGCTTCGCCAGCCCGGATACCGGCCAGGACGGTGGATCTCAGA
Ralstonia metallidurans CH34
Rmet_2789 btuB -260 45.1 TACACTCGCCCCCGTTCCAGGTGCTCGCGCCCTGCTCTTACAGGGCTGCAGTTCAACGGGAAACAGGGAGCCGGGCGCCGAAATCCATATCGGGGCAGGCCAACCTGTGCTGCCCCCGCAACGGTAAGCGACCGCGAACGCCCGCCACGAGCGGCTCGCAGGGCCGGCCAAACGCCACTGAATCTGAATCGTCACGATCTGATCGGGAAGGCGGCCAGCCTGATGTCGTCAGCCCGGATACCGGCCTGCAGAACGAGGGTATGC
Ralstonia eutropha JMP134
Reut_A0654 btuB -322 47.7 CACTCGCGCACGTTCCAGGTGCTCGCCATCCGCCCAAGGCAGATTGGCAGTTCAACGGGAAACAGGGAGCCGCGGCCGACGAACAGCTCGGCCAGGCCAACCTGTGCTGCCCCCGCAACGGTAAGCGGCCGCGATGCCTGCCCACACGGCGTCGCAGGGCTGGCCAATCGCCACTGAACCTCACGCGTTCGGGAAGGCGGCCAGTCCCGAGCCGCCAGCCCGGATACCGGCCTGAACGCGGGCTGCCGCCCC
Ralstonia eutropha H16
H16_A2972 btuB -219 24.1 ACCGGCCACACGCCACTGAACCGCAGGTTCGGGAAGGCGCCGG
Cupriavidus taiwanensis
RALTA_A2446 btuB -163 27 GACCGGCCACACGCCACTGAACCGCAGGTTCGGGAAGGCGCCGGTT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD